Human DPYD(Dihydropyrimidine Dehydrogenase) ELISA Kit

Human DPYD(Dihydropyrimidine Dehydrogenase) ELISA Kit

To Order Contact us: [email protected]

Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RD-DPYD-Hu-48Tests 48 Tests
EUR 521
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RD-DPYD-Hu-96Tests 96 Tests
EUR 723
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
DLR-DPYD-Mu-48T 48T
EUR 527
  • Should the Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
DLR-DPYD-Mu-96T 96T
EUR 688
  • Should the Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
DLR-DPYD-Ra-48T 48T
EUR 549
  • Should the Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dihydropyrimidine Dehydrogenase (DPYD) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
DLR-DPYD-Ra-96T 96T
EUR 718
  • Should the Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dihydropyrimidine Dehydrogenase (DPYD) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RDR-DPYD-Mu-48Tests 48 Tests
EUR 557
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RDR-DPYD-Mu-96Tests 96 Tests
EUR 774
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RDR-DPYD-Ra-48Tests 48 Tests
EUR 583
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RDR-DPYD-Ra-96Tests 96 Tests
EUR 811
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RD-DPYD-Mu-48Tests 48 Tests
EUR 533
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RD-DPYD-Mu-96Tests 96 Tests
EUR 740
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RD-DPYD-Ra-48Tests 48 Tests
EUR 557
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
RD-DPYD-Ra-96Tests 96 Tests
EUR 775
Human Dihydropyrimidine Dehydrogenase,DPYD ELISA Kit
201-12-0950 96 tests
EUR 440
  • This Dihydropyrimidine Dehydrogenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
20-abx151348
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx252346-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human DPYD(Dihydropyrimidine Dehydrogenase) ELISA Kit
EH2958 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q12882
  • Alias: DPYD/Dihydropyrimidine Dehydrogenase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Dihydropyrimidine Dehydrogenase(DPYD)ELISA Kit
GA-E0966HM-48T 48T
EUR 289
Human Dihydropyrimidine Dehydrogenase(DPYD)ELISA Kit
GA-E0966HM-96T 96T
EUR 466
Human Dihydropyrimidine Dehydrogenase(DPYD)ELISA Kit
QY-E03697 96T
EUR 361
Human Dihydropyrimidine Dehydrogenase ELISA Kit (DPYD)
RK01281 96 Tests
EUR 521
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidine Dehydrogenase (DPYD) in serum, plasma, tissue homogenates and other biological fluids.
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidine Dehydrogenase (DPYD) in serum, plasma, tissue homogenates and other biological fluids.
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidine Dehydrogenase (DPYD) in serum, plasma, tissue homogenates and other biological fluids.
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidine Dehydrogenase (DPYD) in serum, plasma, tissue homogenates and other biological fluids.
Human Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
4-SEC012Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dihydropyrimidine Dehydrogenase elisa. Alternative names of the recognized antigen: DPD
  • DHPDHase
  • Dihydrothymine dehydrogenase
  • Dihydrouracil dehydrogenase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dihydropyrimidine Dehydrogenase (DPYD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx176174
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
abx117126-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx128372
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx129418
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
abx149803-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx172122
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx327545
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx301020
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody
20-abx001364
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Dihydropyrimidine Dehydrogenase (DPYD)
4-RPC012Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q12882
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dihydropyrimidine Dehydrogenase expressed in: E.coli
Recombinant Dihydropyrimidine Dehydrogenase (DPYD)
4-RPC012Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CHR6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dihydropyrimidine Dehydrogenase expressed in: E.coli
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
20-abx153929
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Pig Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx360551-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx358757-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx355711-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx363711-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx364279-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx571165-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx576686-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Cow Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx519126-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Dihydropyrimidine Dehydrogenase(DPYD)ELISA Kit
GA-E0964MS-48T 48T
EUR 336
Mouse Dihydropyrimidine Dehydrogenase(DPYD)ELISA Kit
GA-E0964MS-96T 96T
EUR 534
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
SEC012Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Dihydropyrimidine Dehydrogenase (DPYD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
4-SEC012Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dihydropyrimidine Dehydrogenase elisa. Alternative names of the recognized antigen: DPD
  • DHPDHase
  • Dihydrothymine dehydrogenase
  • Dihydrouracil dehydrogenase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Dihydropyrimidine Dehydrogenase (DPYD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Dihydropyrimidine Dehydrogenase (DPYD) Protein
20-abx166910
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Dihydropyrimidine Dehydrogenase (DPYD) CLIA Kit
abx195538-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Dihydropyrimidine Dehydrogenase (DPYD) CLIA Kit
20-abx493370
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human DPYD (Dihydropyrimidine Dehydrogenase)
E-EL-H0368 1 plate of 96 wells
EUR 534
  • Gentaur's DPYD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPYD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPYD (Dihydropyrimidine Dehydrogenase) in samples from Serum, Plasma, Cell supernatant
Human Dihydropyrimidine dehydrogenase [NADP+], DPYD ELISA KIT
ELI-06468h 96 Tests
EUR 824
ELISA kit for Human DPYD (Dihydropyrimidine Dehydrogenase)
ELK2382 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dihydropyrimidine Dehydrogenase (DPYD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Dihydropyrimidine Dehydrogenase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Dihydropyrimidine dehydrogenase [NADP+](DPYD) ELISA kit
CSB-EL007168HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dihydropyrimidine dehydrogenase [NADP+] (DPYD) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Dihydropyrimidine dehydrogenase [NADP+](DPYD) ELISA kit
1-CSB-EL007168HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dihydropyrimidine dehydrogenase [NADP+](DPYD) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) Protein
20-abx167280
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody (HRP)
20-abx315028
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody (FITC)
20-abx315029
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dihydropyrimidine Dehydrogenase (DPYD) Antibody (Biotin)
20-abx315030
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bovine Dihydropyrimidine dehydrogenase [NADP+], DPYD ELISA KIT
ELI-06465b 96 Tests
EUR 928
Mouse Dihydropyrimidine dehydrogenase [NADP+], Dpyd ELISA KIT
ELI-06466m 96 Tests
EUR 865
Porcine Dihydropyrimidine dehydrogenase [NADP+], DPYD ELISA KIT
ELI-06467p 96 Tests
EUR 928
Guinea pig Dihydropyrimidine Dehydrogenase (DPYD) ELISA Kit
abx357659-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELISA kit for Mouse DPYD (Dihydropyrimidine Dehydrogenase)
ELK6442 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dihydropyrimidine Dehydrogenase (DPYD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Dihydropyrimidine Dehydrogenase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat Dihydropyrimidine dehydrogenase (DPYD)
KTE100740-48T 48T
EUR 332
  • Dihydropyrimidine dehydrogenase (DPD) is an enzyme that is involved in pyrimidine degradation. It is the initial and rate-limiting step in pyrimidine catabolism. It catalyzes the reduction of uracil and thymine. It is also involved in the degradation
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropyrimidine dehydrogenase (DPYD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Dihydropyrimidine dehydrogenase (DPYD)
KTE100740-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Dihydropyrimidine dehydrogenase (DPD) is an enzyme that is involved in pyrimidine degradation. It is the initial and rate-limiting step in pyrimidine catabolism. It catalyzes the reduction of uracil and thymine. It is also involved in the degradation
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropyrimidine dehydrogenase (DPYD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Dihydropyrimidine dehydrogenase (DPYD)
KTE100740-96T 96T
EUR 539
  • Dihydropyrimidine dehydrogenase (DPD) is an enzyme that is involved in pyrimidine degradation. It is the initial and rate-limiting step in pyrimidine catabolism. It catalyzes the reduction of uracil and thymine. It is also involved in the degradation
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropyrimidine dehydrogenase (DPYD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Dihydropyrimidine Dehydrogenase (DPYD) CLIA Kit
20-abx493371
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human)
4-PAC012Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD)
CLIA kit for Human DPYD (Dihydropyrimidine Dehydrogenase)
E-CL-H0299 1 plate of 96 wells
EUR 584
  • Gentaur's DPYD CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DPYD . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DPYD (Dihydropyrimidine Dehydrogenase) in samples from Serum, Plasma, Cell supernatant
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse)
4-PAC012Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD)
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), APC
4-PAC012Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with APC.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), Biotinylated
4-PAC012Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with Biotin.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), Cy3
4-PAC012Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with Cy3.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), FITC
4-PAC012Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with FITC.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), HRP
4-PAC012Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with HRP.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), PE
4-PAC012Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with PE.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), APC
4-PAC012Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with APC.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), Biotinylated
4-PAC012Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with Biotin.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), Cy3
4-PAC012Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with Cy3.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), FITC
4-PAC012Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with FITC.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), HRP
4-PAC012Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with HRP.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), PE
4-PAC012Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with PE.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Human), APC-Cy7
4-PAC012Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Ile781~Cys1025)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with APC-Cy7.
Dihydropyrimidine Dehydrogenase (DPYD) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC012Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPYD (Pro169~Asp422)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dihydropyrimidine Dehydrogenase (DPYD). This antibody is labeled with APC-Cy7.
Human Dihydropyrimidine Dehydrogenase ELISA kit
E01D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dihydropyrimidine Dehydrogenase ELISA kit
E01D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dihydropyrimidine Dehydrogenase ELISA kit
E01D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dihydropyrimidine Dehydrogenase ELISA Kit
ELA-E2012h 96 Tests
EUR 824
Rat Dihydropyrimidine Dehydrogenase ELISA kit
E02D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Dihydropyrimidine Dehydrogenase ELISA kit
E02D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Dihydropyrimidine Dehydrogenase ELISA kit
E02D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Dihydropyrimidine Dehydrogenase ELISA kit
E03D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Dihydropyrimidine Dehydrogenase ELISA kit
E03D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Dihydropyrimidine Dehydrogenase ELISA kit
E03D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Dihydropyrimidine Dehydrogenase ELISA kit
E06D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Dihydropyrimidine Dehydrogenase ELISA kit
E06D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Dihydropyrimidine Dehydrogenase ELISA kit
E06D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Dihydropyrimidine Dehydrogenase ELISA kit
E04D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Dihydropyrimidine Dehydrogenase ELISA kit
E04D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Dihydropyrimidine Dehydrogenase ELISA kit
E04D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Dihydropyrimidine Dehydrogenase ELISA kit
E09D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Dihydropyrimidine Dehydrogenase ELISA kit
E09D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Dihydropyrimidine Dehydrogenase ELISA kit
E09D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Dihydropyrimidine Dehydrogenase ELISA kit
E08D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Dihydropyrimidine Dehydrogenase ELISA kit
E08D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Dihydropyrimidine Dehydrogenase ELISA kit
E08D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Dihydropyrimidine Dehydrogenase ELISA kit
E07D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Dihydropyrimidine Dehydrogenase ELISA kit
E07D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Dihydropyrimidine Dehydrogenase ELISA kit
E07D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Dihydropyrimidine Dehydrogenase ELISA kit
E05D0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Dihydropyrimidine Dehydrogenase ELISA kit
E05D0256-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Dihydropyrimidine Dehydrogenase ELISA kit
E05D0256-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropyrimidine Dehydrogenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dpyd/ Rat Dpyd ELISA Kit
ELI-06469r 96 Tests
EUR 886
Human DPYD ELISA Kit
EHD0263 96Tests
EUR 521
DPYD ELISA KIT|Human
EF006763 96 Tests
EUR 689
Goat DPYD ELISA Kit
EGTD0263 96Tests
EUR 521
Bovine DPYD ELISA Kit
EBD0263 96Tests
EUR 521
Canine DPYD ELISA Kit
ECD0263 96Tests
EUR 521
Chicken DPYD ELISA Kit
ECKD0263 96Tests
EUR 521
Anserini DPYD ELISA Kit
EAD0263 96Tests
EUR 521
Mouse DPYD ELISA Kit
EMD0263 96Tests
EUR 521
Rat DPYD ELISA Kit
ERD0263 96Tests
EUR 521
Sheep DPYD ELISA Kit
ESD0263 96Tests
EUR 521
Rabbit DPYD ELISA Kit
ERTD0263 96Tests
EUR 521
Monkey DPYD ELISA Kit
EMKD0263 96Tests
EUR 521
Porcine DPYD ELISA Kit
EPD0263 96Tests
EUR 521
Guinea Pig DPYD ELISA Kit
EGD0263 96Tests
EUR 521
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
DPYD antibody
22317-100ul 100ul
EUR 390
DPYD antibody
70R-13562 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DPYD antibody
DPYD antibody
70R-14298 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal DPYD antibody
DPYD Antibody
32346-100ul 100ul
EUR 252
DPYD Antibody
42963-100ul 100ul
EUR 252
DPYD Antibody
1-CSB-PA005172
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DPYD. Recognizes DPYD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
DPYD Antibody
1-CSB-PA622516LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPYD. Recognizes DPYD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
DPYD Antibody
DF6507 200ul
EUR 304
Description: DPYD Antibody detects endogenous levels of total DPYD.
DPYD Antibody
CSB-PA007168KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against DPYD. Recognizes DPYD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
DPYD Antibody
CSB-PA007168KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against DPYD. Recognizes DPYD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
DPYD siRNA
20-abx901575
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DPYD siRNA
20-abx914593
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DPYD siRNA
20-abx914594
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DPYD Antibody
ABD6507 100 ug
EUR 438
pENTR223- DPYD
PVT10065 2 ug
EUR 266
Human DPYD shRNA Plasmid
20-abx951258
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
DPYD Rabbit pAb
A1620-100ul 100 ul
EUR 308
DPYD Rabbit pAb
A1620-200ul 200 ul
EUR 459
DPYD Rabbit pAb
A1620-20ul 20 ul
EUR 183
DPYD Rabbit pAb
A1620-50ul 50 ul
EUR 223
DPYD Polyclonal Antibody
41635-100ul 100ul
EUR 252
DPYD Polyclonal Antibody
41635-50ul 50ul
EUR 187
DPYD Blocking Peptide
DF6507-BP 1mg
EUR 195
Anti-DPYD Antibody
A01749 100ug/vial
EUR 294
DPYD Conjugated Antibody
C32346 100ul
EUR 397
DPYD cloning plasmid
CSB-CL622516HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 522
  • Sequence: atggcccctgtgctcagtaaggactcggcggacatcgagagtatcctggctttaaatcctcgaacacaaactcatgcaactctgtgttccacttcggccaagaaattagacaagaaacattggaaaagaaatcctgataagaactgctttaattgtgagaagctggagaataattt
  • Show more
Description: A cloning plasmid for the DPYD gene.
DPYD cloning plasmid
CSB-CL622516HU2-10ug 10ug
EUR 1104
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3078
  • Sequence: ATGGCCCCTGTGCTCAGTAAGGACTCGGCGGACATCGAGAGTATCCTGGCTTTAAATCCTCGAACACAAACTCATGCAACTCTGTGTTCCACTTCGGCCAAGAAATTAGACAAGAAACATTGGAAAAGAAATCCTGATAAGAACTGCTTTAATTGTGAGAAGCTGGAGAATAATT
  • Show more
Description: A cloning plasmid for the DPYD gene.
DPYD Polyclonal Antibody
ABP52958-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human DPYD
  • Applications tips:
Description: A polyclonal antibody for detection of DPYD from Human, Mouse, Rat. This DPYD antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DPYD
DPYD Polyclonal Antibody
ABP52958-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human DPYD
  • Applications tips:
Description: A polyclonal antibody for detection of DPYD from Human, Mouse, Rat. This DPYD antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DPYD
DPYD Polyclonal Antibody
ABP52958-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human DPYD
  • Applications tips:
Description: A polyclonal antibody for detection of DPYD from Human, Mouse, Rat. This DPYD antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DPYD
DPYD Polyclonal Antibody
ES3957-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DPYD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
DPYD Polyclonal Antibody
ES3957-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DPYD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Anti-DPYD Antibody
PA1761 100ug/vial
EUR 294
Anti-DPYD antibody
STJ23425 100 µl
EUR 277
Description: The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene.
Anti-DPYD antibody
STJ96592 200 µl
EUR 197
Description: Rabbit polyclonal to DPYD.
Anti-DPYD (7D4)
YF-MA10253 100 ug
EUR 363
Description: Mouse monoclonal to DPYD
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
DPYD ORF Vector (Human) (pORF)
ORF003267 1.0 ug DNA
EUR 95
DPYD ORF Vector (Human) (pORF)
ORF012879 1.0 ug DNA
EUR 354
Scroll to Top