Human GNLY(Granulysin) ELISA Kit

Human GNLY(Granulysin) ELISA Kit

To Order Contact us: [email protected]

Human Granulysin (GNLY) ELISA Kit

RD-GNLY-Hu-96Tests 96 Tests
EUR 692

Human Granulysin (GNLY) ELISA Kit

RDR-GNLY-Hu-48Tests 48 Tests
EUR 522

Human Granulysin (GNLY) ELISA Kit

RDR-GNLY-Hu-96Tests 96 Tests
EUR 724

Human Granulysin (GNLY) ELISA Kit

abx571955-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human GNLY/ Granulysin ELISA Kit

E1028Hu 1 Kit
EUR 571

Human GNLY(Granulysin) ELISA Kit

EH0156 96T
EUR 524.1
  • Detection range: 0.234-15 ng/ml
  • Uniprot ID: P22749
  • Alias: GNLY(Granulysin)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml

Human Granulysin, GNLY ELISA KIT

ELI-05002h 96 Tests
EUR 824

Human granulysin(GNLY)ELISA Kit

GA-E0371HM-48T 48T
EUR 289

Human granulysin(GNLY)ELISA Kit

GA-E0371HM-96T 96T
EUR 466

Human Granulysin (GNLY) ELISA Kit

20-abx151728
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granulysin (GNLY) ELISA Kit

abx250848-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human granulysin,GNLY ELISA Kit

201-12-0355 96 tests
EUR 440
  • This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human granulysin, GNLY ELISA Kit

CSB-E09936h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granulysin, GNLY ELISA Kit

1-CSB-E09936h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

4-SEB517Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5
  • LAG-2
  • TLA519
  • T-Lymphocyte Activation Gene 519
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Granulysin ELISA Kit (GNLY)

RK01482 96 Tests
EUR 521

Human granulysin(GNLY)ELISA Kit

QY-E02489 96T
EUR 361

Granulysin (GNLY) Antibody

abx027191-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Granulysin (GNLY) Antibody

abx027191-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Granulysin (GNLY) Antibody

20-abx172666
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granulysin (GNLY) Antibody

20-abx176697
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granulysin (GNLY) Protein

20-abx262124
  • EUR 328.00
  • EUR 5089.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Bovine granulysin,GNLY

QY-E60016 96T
EUR 426

Chicken Granulysin (GNLY) ELISA Kit

abx354664-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Granulysin (GNLY) ELISA Kit

abx354943-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Granulysin (GNLY) ELISA Kit

abx355092-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Granulysin (GNLY) ELISA Kit

abx355341-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Bovine granulysin,GNLY ELISA Kit

QY-E60039 96T
EUR 426

ELISA kit for Human GNLY (Granulysin)

ELK2059 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY
  • Show more
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GNLY (Granulysin)

E-EL-H1618 1 plate of 96 wells
EUR 534
  • Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

Human Granulysin (GNLY) Protein

20-abx653629
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Granulysin (GNLY) CLIA Kit

20-abx492830
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Granulysin (GNLY) CLIA Kit

abx197066-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human GNLY (Granulysin)

E-CL-H1038 1 plate of 96 wells
EUR 584
  • Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

GNLY Granulysin Human Recombinant Protein

PROTP22749 Regular: 10ug
EUR 317
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques.

Human granulysin ELISA Kit

CN-04210H1 96T
EUR 452

Human granulysin ELISA Kit

CN-04210H2 48T
EUR 302

Human GNLY ELISA Kit

ELA-E1517h 96 Tests
EUR 824

GNLY ELISA KIT|Human

EF000128 96 Tests
EUR 689

ELISA kit for Human Granulysin

EK3724 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Granulysin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Granulysin PicoKine ELISA Kit

EK1280 96 wells
EUR 425
Description: For quantitative detection of human Granulysin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Recombinant Human Granulysin

7-05281 2µg Ask for price

Recombinant Human Granulysin

7-05282 10µg Ask for price

Recombinant Human Granulysin

7-05283 1mg Ask for price

Recombinant human Granulysin

P1693 100ug Ask for price
  • Uniprot ID: P22749
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Granulysin

Human Granulysin PicoKine™ Fast ELISA Kit

FEK1280 96 wells
EUR 475
Description: The Fast version of Picokine ELISA kits, assay takes less than 1.5 hours. Detect Human Granulysin/GNLY with <10pg/ml sensitivity. Format: 96-well plate with removable strips. Compatible samples: cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). This is a TMB colorimetric sandwich ELISA kit with short assay time and fast experiment set up. Granulysin/GNLY tissue specificity: Expressed in natural killer and T-cells.

Granulysin antibody

70R-2751 50 ug
EUR 467
Description: Rabbit polyclonal Granulysin antibody raised against the n terminal of GNLY

GNLY siRNA

20-abx918218
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNLY Antibody

43674-100ul 100ul
EUR 252

anti-GNLY

YF-PA17076 50 ug
EUR 363
Description: Mouse polyclonal to GNLY

Human GNLY shRNA Plasmid

20-abx957198
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNLY Recombinant Protein (Human)

RP013579 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Granulysin Blocking Peptide

33R-5745 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNLY antibody, catalog no. 70R-2751

GNLY Conjugated Antibody

C43674 100ul
EUR 397

GNLY cloning plasmid

CSB-CL009627HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 438
  • Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac
  • Show more
Description: A cloning plasmid for the GNLY gene.

GNLY Polyclonal Antibody

ES11035-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNLY Polyclonal Antibody

ES11035-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
Scroll to Top