Human UBD(Ubiquitin D) ELISA Kit

Human UBD(Ubiquitin D) ELISA Kit

To Order Contact us: [email protected]

Human Ubiquitin D (UBD) ELISA Kit

RDR-UBD-Hu-48Tests 48 Tests
EUR 522

Human Ubiquitin D (UBD) ELISA Kit

RDR-UBD-Hu-96Tests 96 Tests
EUR 724

Human Ubiquitin D (UBD) ELISA Kit

RD-UBD-Hu-48Tests 48 Tests
EUR 500

Human Ubiquitin D (UBD) ELISA Kit

RD-UBD-Hu-96Tests 96 Tests
EUR 692

Human Ubiquitin D (UBD) ELISA Kit

abx575225-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human UBD(Ubiquitin D) ELISA Kit

EH3937 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: O15205
  • Alias: UBD/Diubiquitin/FAT10diubiquitin/GABBR1/UBD-3/ubiquitin D/Ubiquitin-like protein FAT10
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human ubiquitin D,UBD ELISA Kit

ELA-E1744h 96 Tests
EUR 824

Human UBD/ Ubiquitin D ELISA Kit

E2623Hu 1 Kit
EUR 571

Human Ubiquitin D, UBD ELISA KIT

ELI-05657h 96 Tests
EUR 824

Human ubiquitin D(UBD)ELISA Kit

GA-E1634HM-48T 48T
EUR 289

Human ubiquitin D(UBD)ELISA Kit

GA-E1634HM-96T 96T
EUR 466

Human Ubiquitin D (UBD) ELISA Kit

20-abx153426
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ubiquitin D (UBD) ELISA Kit

abx051880-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ubiquitin D (UBD) ELISA Kit

abx253338-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

human ubiquitin D,UBD ELISA Kit

201-12-1618 96 tests
EUR 440
  • This ubiquitin D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

4-SEB744Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ubiquitin D elisa. Alternative names of the recognized antigen: UB-D
  • FAT10
  • UBD-3
  • Diubiquitin
  • Ubiquitin-like protein FAT10
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ubiquitin D (UBD) in samples from Serum, plasma and other biological fluids.  with no significant corss-reactivity with analogues from other species.

Human ubiquitin D(UBD)ELISA Kit

QY-E03662 96T
EUR 361

Human Ubiquitin D (UBD)

1-CSB-EP025435HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin D(UBD) expressed in E.coli

Mouse Ubiquitin D (UBD) ELISA Kit

abx518320-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Ubiquitin D (UBD) ELISA Kit

abx518321-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Ubiquitin D (UBD) ELISA Kit

abx359951-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Ubiquitin D (UBD) ELISA Kit

abx361703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Ubiquitin D (UBD) ELISA Kit

abx362868-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Ubiquitin D, Ubd ELISA KIT

ELI-05656m 96 Tests
EUR 865

Sheep Ubiquitin D (UBD) ELISA Kit

abx364505-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Ubiquitin D (UBD) ELISA Kit

abx355671-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human UBD (Ubiquitin D)

ELK2165 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ubiquitin D (UBD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ubiquitin D (UBD
  • Show more
Description: A sandwich ELISA kit for detection of Ubiquitin D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human UBD (Ubiquitin D)

E-EL-H1253 1 plate of 96 wells
EUR 534
  • Gentaur's UBD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human UBD. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-48T 48T
EUR 354
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-96T 96T
EUR 572
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ubiquitin D (UBD) Antibody

20-abx116415
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx122611-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx036401-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

20-abx100688
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody

20-abx100689
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody

20-abx004208
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

20-abx175021
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ubiquitin D (UBD) Antibody

abx239160-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ubiquitin D (UBD) Antibody

20-abx301311
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Protein

20-abx263451
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Recombinant Ubiquitin D (UBD)

4-RPB744Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O15205
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Ubiquitin D expressed in: E.coli

Recombinant Ubiquitin D (UBD)

4-RPB744Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q921A3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 9.2
Description: Recombinant Rat Ubiquitin D expressed in: E.coli

Human Ubiquitin D (UBD) CLIA Kit

20-abx493037
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Ubiquitin D (UBD) CLIA Kit

abx197881-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Ubiquitin D (UBD) Protein

20-abx069592
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Human UBD (Ubiquitin D)

E-CL-H0813 1 plate of 96 wells
EUR 584
  • Gentaur's UBD CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human UBD . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant

Rat Ubiquitin D (UBD) Protein

20-abx069593
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody (HRP)

20-abx305851
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody (FITC)

20-abx305852
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody (Biotin)

20-abx305853
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UBD Ubiquitin-D Human Recombinant Protein

PROTO15205 Regular: 5ug
EUR 317
Description: UBD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 188 amino acids (1-165 a.a.) and having a molecular mass of 20.9kDa.;UBD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Ubiquitin D (UBD) Polyclonal Antibody (Rat)

4-PAB744Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD)

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse)

4-PAB744Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD)

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC

4-PAB744Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAB744Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Biotin.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Cy3

4-PAB744Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Cy3.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), FITC

4-PAB744Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with FITC.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), HRP

4-PAB744Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with HRP.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), PE

4-PAB744Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with PE.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC

4-PAB744Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), Biotinylated

4-PAB744Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Biotin.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), Cy3

4-PAB744Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Cy3.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), FITC

4-PAB744Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with FITC.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), HRP

4-PAB744Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with HRP.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), PE

4-PAB744Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with PE.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAB744Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC-Cy7.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC-Cy7

4-PAB744Ra01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC-Cy7.

Ubd/ Rat Ubd ELISA Kit

ELI-05658r 96 Tests
EUR 886

UBD ELISA KIT|Human

EF007240 96 Tests
EUR 689

UBD ELISA Kit (Human) (OKCD02967)

OKCD02967 96 Wells
EUR 792
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Conjugation ability activated by UBA6. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases such as polycystic kidney disease and Human immunodeficiency virus (HIV)-associated nephropathy (HIVAN).1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.34 ng/mL

UBD ELISA Kit (Mouse) (OKEH05353)

OKEH05353 96 Wells
EUR 662
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

UBD ELISA Kit (Rat) (OKEH06112)

OKEH06112 96 Wells
EUR 662
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

Ubiquitin D antibody

70R-5744 50 ug
EUR 467
Description: Rabbit polyclonal Ubiquitin D antibody raised against the N terminal of UBD

Ubiquitin D Antibody

49304-100ul 100ul
EUR 333

Ubiquitin D Antibody

49304-50ul 50ul
EUR 239

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

UBD siRNA

20-abx905902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBD siRNA

20-abx938751
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBD siRNA

20-abx938752
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBD antibody

70R-21094 50 ul
EUR 435
Description: Rabbit polyclonal UBD antibody

UBD Antibody

ABD7373 100 ug
EUR 438

UBD antibody

38663-100ul 100ul
EUR 252

UBD Antibody

DF7373 200ul
EUR 304
Description: UBD Antibody detects endogenous levels of total UBD.

UBD Antibody

1-CSB-PA025435GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

UBD Antibody

1-CSB-PA025435LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Ubiquitin D Conjugated Antibody

C49304 100ul
EUR 397

Ubiquitin D Blocking Peptide

33R-8192 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBD antibody, catalog no. 70R-5744

Human UBD shRNA Plasmid

20-abx957162
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBD Recombinant Protein (Human)

RP033664 100 ug Ask for price

Human Ubiquitin ELISA kit

E01U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit

E01U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit

E01U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ubiquitin ELISA KIT|Human

EF004023 96 Tests
EUR 689

Polyclonal UBD Antibody

APR11237G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBD . This antibody is tested and proven to work in the following applications:

UBD Conjugated Antibody

C38663 100ul
EUR 397

UBD cloning plasmid

CSB-CL025435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atggctcccaatgcttcctgcctctgtgtgcatgtccgttccgaggaatgggatttaatgacctttgatgccaacccatatgacagcgtgaaaaaaatcaaagaacatgtccggtctaagaccaaggttcctgtgcaggaccaggttcttttgctgggctccaagatcttaaagcc
  • Show more
Description: A cloning plasmid for the UBD gene.

anti- UBD antibody

FNab09160 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin D
  • Uniprot ID: O15205
  • Gene ID: 10537
Description: Antibody raised against UBD

UBD Polyclonal Antibody

A50572 100 µg
EUR 570.55
Description: reagents widely cited

UBD Rabbit pAb

A5491-100ul 100 ul
EUR 308

UBD Rabbit pAb

A5491-200ul 200 ul
EUR 459

UBD Rabbit pAb

A5491-20ul 20 ul
EUR 183

UBD Rabbit pAb

A5491-50ul 50 ul
EUR 223

UBD Rabbit pAb

A13397-100ul 100 ul
EUR 308

UBD Rabbit pAb

A13397-200ul 200 ul
EUR 459

UBD Rabbit pAb

A13397-20ul 20 ul
EUR 183

UBD Rabbit pAb

A13397-50ul 50 ul
EUR 223

UBD Blocking Peptide

DF7373-BP 1mg
EUR 195

Anti-UBD antibody

PAab09160 100 ug
EUR 386

pENTR223-UBD vector

PVT11863 2 ug
EUR 304

Anti-UBD antibody

STJ27444 100 µl
EUR 277

Anti-UBD antibody

STJ115359 100 µl
EUR 277

UBD ORF Vector (Human) (pORF)

ORF011222 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Ubiquitin(Ub)ELISA Kit

GA-E1635HM-48T 48T
EUR 289

Human Ubiquitin(Ub)ELISA Kit

GA-E1635HM-96T 96T
EUR 466

Human Ubiquitin (Ub) ELISA Kit

abx253335-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Ubiquitin,Ub ELISA Kit

201-12-1619 96 tests
EUR 440
  • This Ubiquitin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ubiquitin (Ub) ELISA Kit

DLR-Ub-Hu-48T 48T
EUR 479
  • Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids.

Human Ubiquitin (Ub) ELISA Kit

DLR-Ub-Hu-96T 96T
EUR 621
  • Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids.

Human Ubiquitin,Ub ELISA Kit

CN-04289H1 96T
EUR 434

Human Ubiquitin,Ub ELISA Kit

CN-04289H2 48T
EUR 284

Human Ubiquitin (Ub) ELISA Kit

RDR-Ub-Hu-48Tests 48 Tests
EUR 500

Human Ubiquitin (Ub) ELISA Kit

RDR-Ub-Hu-96Tests 96 Tests
EUR 692

Human Ubiquitin (Ub) ELISA Kit

RD-Ub-Hu-48Tests 48 Tests
EUR 478

Human Ubiquitin (Ub) ELISA Kit

RD-Ub-Hu-96Tests 96 Tests
EUR 662

Human Ubiquitin(Ub)ELISA Kit

QY-E03663 96T
EUR 361

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Anti-Ubiquitin D Rabbit Monoclonal Antibody

M01970 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ubiquitin D Antibody. Validated in IF, WB and tested in Human, Mouse.

Mouse UBD shRNA Plasmid

20-abx973642
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat UBD shRNA Plasmid

20-abx985328
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-FAT10/UBD Antibody

A01970-1 100ug/vial
EUR 294

UBD protein (His tag)

80R-1964 10 ug
EUR 322
Description: Recombinant human UBD protein (His tag)

UBD Antibody, HRP conjugated

1-CSB-PA025435LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBD Antibody, FITC conjugated

1-CSB-PA025435LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBD Antibody, Biotin conjugated

1-CSB-PA025435LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Diubiquitin/UBD Antibody

PA2222 100ug/vial
EUR 334

UBD Recombinant Protein (Rat)

RP235514 100 ug Ask for price

UBD Recombinant Protein (Mouse)

RP182609 100 ug Ask for price

14,15-DHET Human Urine ELISA Kit

DH3 1 Kit
EUR 323

Fmoc-D-Ala-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)

D-1425.0001 1.0g
EUR 236

Fmoc-D-Ala-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)

D-1425.0005 5.0g
EUR 841

Boc-D-Ala-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1495.0001 1.0g
EUR 381

Boc-D-Ala-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1495.0005 5.0g
EUR 1421

Boc-D-Asn-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1570.0001 1.0g
EUR 122

Boc-D-Asn-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1570.0005 5.0g
EUR 381

Fmoc-D-Leu-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1765.0001 1.0g
EUR 261

Fmoc-D-Leu-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1765.0005 5.0g
EUR 925

Fmoc-D-Phe-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1770.0001 1.0g
EUR 261

Fmoc-D-Phe-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1770.0005 5.0g
EUR 925

Fmoc-D-Val-Wang resin (200-400 mesh, 0.6-0.9 mmol/g)

D-2465.0001 1.0g
EUR 176

Fmoc-D-Val-Wang resin (200-400 mesh, 0.6-0.9 mmol/g)

D-2465.0005 5.0g
EUR 611

Fmoc-D-Leu-Wang resin (200-400 mesh, 0.50-1.00 mmol/g)

D-2535.0001 1.0g
EUR 151

Fmoc-D-Leu-Wang resin (200-400 mesh, 0.50-1.00 mmol/g)

D-2535.0005 5.0g
EUR 515

Fmoc-D-Val-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)

D-2690.0001 1.0g
EUR 145

Fmoc-D-Val-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)

D-2690.0005 5.0g
EUR 477

UBD sgRNA CRISPR Lentivector set (Human)

K2570101 3 x 1.0 ug
EUR 339

Human cathepsin D,cath-D ELISA Kit

201-12-0865 96 tests
EUR 440
  • This cathepsin D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cathepsin D, cath-D ELISA Kit

CSB-E09221h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cathepsin D, cath-D in samples from serum, plasma, tissue homogenates, asciticfluid. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human cathepsin D, cath-D ELISA Kit

1-CSB-E09221h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cathepsin D, cath-D in samples from serum, plasma, tissue homogenates, asciticfluid. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human cathepsin D,cath-D ELISA Kit

CN-04595H1 96T
EUR 447

Human cathepsin D,cath-D ELISA Kit

CN-04595H2 48T
EUR 296

Human Apolipoprotein D(APO-D)ELISA Kit

QY-E00326 96T
EUR 361

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Fmoc-D-Arg(Pmc)-Wang resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1560.0001 1.0g
EUR 261

Fmoc-D-Arg(Pmc)-Wang resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1560.0005 5.0g
EUR 961

Fmoc-D-Glu(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1775.0001 1.0g
EUR 170

Fmoc-D-Glu(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1775.0005 5.0g
EUR 587

Fmoc-D-Asn(Trt)-SASRIN resin (200-400 mesh, 0.3-0.6 mmol/g)

D-1780.0001 1.0g
EUR 454

Fmoc-D-Asn(Trt)-SASRIN resin (200-400 mesh, 0.3-0.6 mmol/g)

D-1780.0005 5.0g
EUR 1698

Fmoc-D-Lys(Boc)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1785.0001 1.0g
EUR 309

Fmoc-D-Lys(Boc)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1785.0005 5.0g
EUR 1143

Fmoc-D-Pen(Trt)-Wang resin (200-400 mesh, 0.25-0.55 mmol/g)

D-1870.0001 1.0g
EUR 381

Fmoc-D-Pen(Trt)-Wang resin (200-400 mesh, 0.25-0.55 mmol/g)

D-1870.0005 5.0g
EUR 1421

Fmoc-D-Trp(Boc)-Wang resin (200-400 mesh, 0.5-0.8 mmol/g)

D-1905.0001 1.0g
EUR 261

Fmoc-D-Trp(Boc)-Wang resin (200-400 mesh, 0.5-0.8 mmol/g)

D-1905.0005 5.0g
EUR 925

Fmoc-D-Cys(Trt)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1985.0001 1.0g
EUR 454

Fmoc-D-Cys(Trt)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-1985.0005 5.0g
EUR 1698

Fmoc-D-Arg(Pbf)-Wang resin (200-400 mesh, 0.50-1.00 mmol/g)

D-1995.0001 1.0g
EUR 334

Fmoc-D-Arg(Pbf)-Wang resin (200-400 mesh, 0.50-1.00 mmol/g)

D-1995.0005 5.0g
EUR 1251

Fmoc-D-Asp(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-2680.0001 1.0g
EUR 309

Fmoc-D-Asp(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)

D-2680.0005 5.0g
EUR 1143

H-D-Val-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g)

D-2990.0001 1.0g
EUR 265

H-D-Val-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g)

D-2990.0005 5.0g
EUR 970

Ubiquitin (Ub) ELISA Kit

20-abx576016
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Ubiquitin ELISA kit

E03U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ubiquitin ELISA kit

E03U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ubiquitin ELISA kit

E03U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ubiquitin ELISA kit

E02U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ubiquitin ELISA kit

E02U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ubiquitin ELISA kit

E02U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ubiquitin ELISA kit

E04U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ubiquitin ELISA kit

E04U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ubiquitin ELISA kit

E04U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ubiquitin ELISA kit

E08U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ubiquitin ELISA kit

E08U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ubiquitin ELISA kit

E08U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ubiquitin ELISA kit

E07U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ubiquitin ELISA kit

E07U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ubiquitin ELISA kit

E07U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ubiquitin ELISA kit

E06U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ubiquitin ELISA kit

E06U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ubiquitin ELISA kit

E06U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ubiquitin ELISA kit

E09U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ubiquitin ELISA kit

E09U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ubiquitin ELISA kit

E09U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ubiquitin (Ub) ELISA Kit

20-abx153546
  • EUR 6971.00
  • EUR 3714.00
  • EUR 864.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human ubiquitin B (UBB) ELISA kit

E01U0044-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ubiquitin B (UBB) ELISA kit

E01U0044-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ubiquitin B (UBB) ELISA kit

E01U0044-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Ub (Ubiquitin)

ELK5287 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ubiquitin (Ub). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ubiquitin (Ub). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Ubiquitin from Human,Mouse,Rat,Rabbit,Dog,Pig,Cattle,Horse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human ubiquitin B (UBB) ELISA kit

CSB-EL025429HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin B (UBB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ubiquitin B (UBB) ELISA kit

1-CSB-EL025429HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin B (UBB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human ubiquitin C (UBC) ELISA kit

CSB-EL025434HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin C (UBC) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ubiquitin C (UBC) ELISA kit

1-CSB-EL025434HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin C (UBC) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Ub (Ubiquitin)

E-EL-H1252 1 plate of 96 wells
EUR 534
  • Gentaur's Ub ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ub. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Ub (Ubiquitin) in samples from Serum, Plasma, Cell supernatant

Human Ubiquitin C(UBC)ELISA Kit

QY-E03664 96T
EUR 400

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Fmoc-D-His(1-Trt)-SASRIN resin (200-400 mesh, 0.2-0.5 mmol/g)

D-1980.0001 1.0g
EUR 244

Fmoc-D-His(1-Trt)-SASRIN resin (200-400 mesh, 0.2-0.5 mmol/g)

D-1980.0005 5.0g
EUR 866

H-D-Arg(Pbf)-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g)

D-2940.0001 1.0g
EUR 265

H-D-Arg(Pbf)-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g)

D-2940.0005 5.0g
EUR 970

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

H-D-Cys(4-methoxytrityl)-2-chlorotrityl resin (200-400 mesh, 0.4-0.7 mmol/g)

D-2485.0001 1.0g
EUR 309

H-D-Cys(4-methoxytrityl)-2-chlorotrityl resin (200-400 mesh, 0.4-0.7 mmol/g)

D-2485.0005 5.0g
EUR 1143

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-100ug

QP6862-ec-100ug 100ug
EUR 408

Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-10ug

QP6862-ec-10ug 10ug
EUR 200

Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-1mg

QP6862-ec-1mg 1mg
EUR 1632

Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-200ug

QP6862-ec-200ug 200ug
EUR 634

Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-500ug

QP6862-ec-500ug 500ug
EUR 1060

Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-50ug

QP6862-ec-50ug 50ug
EUR 263

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Human Surfactant Protein D(SP-D)ELISA Kit

GA-E1091HM-48T 48T
EUR 289

Human Surfactant Protein D(SP-D)ELISA Kit

GA-E1091HM-96T 96T
EUR 466

Human D-Lactate Dehydrogenase(D-LDH)ELISA Kit

GA-E0769HM-48T 48T
EUR 289

Human D-Lactate Dehydrogenase(D-LDH)ELISA Kit

GA-E0769HM-96T 96T
EUR 466

Human D-Lactate Dehydrogenase,D-LDH ELISA Kit

201-12-0753 96 tests
EUR 440
  • This D-Lactate Dehydrogenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Surfactant Protein D,SP-D ELISA Kit

201-12-1075 96 tests
EUR 440
  • This Surfactant Protein D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human D-Lactate Dehydrogenase, D-LDH ELISA Kit

CSB-E11720h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human D-Lactate Dehydrogenase, D-LDH in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human D-Lactate Dehydrogenase, D-LDH ELISA Kit

1-CSB-E11720h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human D-Lactate Dehydrogenase, D-LDH in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Surfactant Protein D,SP-D ELISA Kit

CN-04385H1 96T
EUR 457

Human Surfactant Protein D,SP-D ELISA Kit

CN-04385H2 48T
EUR 306

Human Surfactant Protein D(SP-D)ELISA Kit

QY-E04133 96T
EUR 394

Human D-Lactate Dehydrogenase(D-LDH)ELISA Kit

QY-E04959 96T
EUR 361

UBD Polyclonal Antibody, HRP Conjugated

A50573 100 µg
EUR 570.55
Description: Ask the seller for details

UBD Polyclonal Antibody, FITC Conjugated

A50574 100 µg
EUR 570.55
Description: The best epigenetics products

UBD Polyclonal Antibody, Biotin Conjugated

A50575 100 µg
EUR 570.55
Description: kits suitable for this type of research

h UBD inducible lentiviral particles

LVP022 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, UBD, is fully sequence verified and matched to NCBI accession ID: NM_006398.3

Ubd ORF Vector (Rat) (pORF)

ORF078506 1.0 ug DNA
EUR 506

Ubd ORF Vector (Mouse) (pORF)

ORF060871 1.0 ug DNA
EUR 506

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

UBD sgRNA CRISPR Lentivector (Human) (Target 1)

K2570102 1.0 ug DNA
EUR 154

UBD sgRNA CRISPR Lentivector (Human) (Target 2)

K2570103 1.0 ug DNA
EUR 154

UBD sgRNA CRISPR Lentivector (Human) (Target 3)

K2570104 1.0 ug DNA
EUR 154

UBD Protein Vector (Human) (pPB-C-His)

PV044885 500 ng
EUR 329

UBD Protein Vector (Human) (pPB-N-His)

PV044886 500 ng
EUR 329
Scroll to Top