Human UBD(Ubiquitin D) ELISA Kit
To Order Contact us: [email protected]
Human Ubiquitin D (UBD) ELISA Kit |
RDR-UBD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Ubiquitin D (UBD) ELISA Kit |
RDR-UBD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Ubiquitin D (UBD) ELISA Kit |
RD-UBD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Ubiquitin D (UBD) ELISA Kit |
RD-UBD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
human ubiquitin D,UBD ELISA Kit |
201-12-1618 |
SunredBio |
96 tests |
EUR 440 |
- This ubiquitin D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Ubiquitin D (UBD) ELISA Kit |
abx051880-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Ubiquitin D (UBD) ELISA Kit |
20-abx153426 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Ubiquitin D (UBD) ELISA Kit |
abx253338-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human UBD(Ubiquitin D) ELISA Kit |
EH3937 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 3.125-200 ng/ml
- Uniprot ID: O15205
- Alias: UBD/Diubiquitin/FAT10diubiquitin/GABBR1/UBD-3/ubiquitin D/Ubiquitin-like protein FAT10
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml |
Human UBD/ Ubiquitin D ELISA Kit |
E2623Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Ubiquitin D (UBD) ELISA Kit |
abx575225-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Ubiquitin D (UBD) ELISA Kit |
SEB744Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. . |
Human Ubiquitin D (UBD) ELISA Kit |
SEB744Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. . |
Human Ubiquitin D (UBD) ELISA Kit |
SEB744Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. . |
Human Ubiquitin D (UBD) ELISA Kit |
SEB744Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. . |
Human Ubiquitin D (UBD) ELISA Kit |
4-SEB744Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Ubiquitin D elisa. Alternative names of the recognized antigen: UB-D
- FAT10
- UBD-3
- Diubiquitin
- Ubiquitin-like protein FAT10
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ubiquitin D (UBD) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Ubiquitin D (UBD) |
1-CSB-EP025435HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 34.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Ubiquitin D(UBD) expressed in E.coli |
Monkey Ubiquitin D (UBD) ELISA Kit |
abx359951-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Ubiquitin D (UBD) ELISA Kit |
abx361703-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Ubiquitin D (UBD) ELISA Kit |
abx362868-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Ubiquitin D (UBD) ELISA Kit |
abx355671-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Ubiquitin D (UBD) ELISA Kit |
abx364505-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Ubiquitin D (UBD) ELISA Kit |
abx518320-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Ubiquitin D (UBD) ELISA Kit |
abx518321-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Human UBD (Ubiquitin D) |
E-EL-H1253 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's UBD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human UBD. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human UBD (Ubiquitin D) |
ELK2165 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ubiquitin D (UBD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ubiquitin D (UBD
- Show more
|
Description: A sandwich ELISA kit for detection of Ubiquitin D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Ubiquitin D (UBD) |
KTE60103-48T |
Abbkine |
48T |
EUR 354 |
- Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Ubiquitin D (UBD) |
KTE60103-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Ubiquitin D (UBD) |
KTE60103-96T |
Abbkine |
96T |
EUR 572 |
- Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Ubiquitin D (UBD) Antibody |
20-abx004208 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody |
20-abx100688 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ubiquitin D (UBD) Antibody |
20-abx100689 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ubiquitin D (UBD) Antibody |
20-abx116415 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody |
abx036401-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody |
abx122611-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody |
20-abx175021 |
Abbexa |
|
|
|
Ubiquitin D (UBD) Protein |
20-abx263451 |
Abbexa |
-
EUR 230.00
-
EUR 1609.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody |
abx239160-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Ubiquitin D (UBD) Antibody |
20-abx301311 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Ubiquitin D (UBD) |
4-RPB744Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O15205
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.3kDa
- Isoelectric Point: 9.2
|
Description: Recombinant Human Ubiquitin D expressed in: E.coli |
Recombinant Ubiquitin D (UBD) |
4-RPB744Ra01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q921A3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.3kDa
- Isoelectric Point: 9.2
|
Description: Recombinant Rat Ubiquitin D expressed in: E.coli |
Human Ubiquitin D (UBD) CLIA Kit |
abx197881-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Ubiquitin D (UBD) CLIA Kit |
20-abx493037 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Ubiquitin D (UBD) Protein |
20-abx069592 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CLIA kit for Human UBD (Ubiquitin D) |
E-CL-H0813 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's UBD CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human UBD . Standards or samples are added to the micro CLIA plate wells and combined with the sp
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant |
Rat Ubiquitin D (UBD) Protein |
20-abx069593 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ubiquitin D (UBD) Antibody (HRP) |
20-abx305851 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody (FITC) |
20-abx305852 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin D (UBD) Antibody (Biotin) |
20-abx305853 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UBD Ubiquitin-D Human Recombinant Protein |
PROTO15205 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: UBD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 188 amino acids (1-165 a.a.) and having a molecular mass of 20.9kDa.;UBD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat) |
4-PAB744Ra01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD) |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse) |
4-PAB744Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD) |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC |
4-PAB744Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC. |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAB744Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Biotin. |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAB744Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Cy3. |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), FITC |
4-PAB744Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with FITC. |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), HRP |
4-PAB744Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with HRP. |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), PE |
4-PAB744Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with PE. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC |
4-PAB744Ra01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), Biotinylated |
4-PAB744Ra01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Biotin. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), Cy3 |
4-PAB744Ra01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Cy3. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), FITC |
4-PAB744Ra01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with FITC. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), HRP |
4-PAB744Ra01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with HRP. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), PE |
4-PAB744Ra01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with PE. |
Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAB744Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Gly165)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC-Cy7. |
Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAB744Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBD (Met1~Thr155)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC-Cy7. |
UBD ELISA Kit (Human) (OKCD02967) |
OKCD02967 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Conjugation ability activated by UBA6. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases such as polycystic kidney disease and Human immunodeficiency virus (HIV)-associated nephropathy (HIVAN).1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.34 ng/mL |
UBD ELISA Kit (Mouse) (OKEH05353) |
OKEH05353 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL |
UBD ELISA Kit (Rat) (OKEH06112) |
OKEH06112 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL |
Ubiquitin D Antibody |
49304-100ul |
SAB |
100ul |
EUR 333 |
Ubiquitin D Antibody |
49304-50ul |
SAB |
50ul |
EUR 239 |
Ubiquitin D antibody |
70R-5744 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Ubiquitin D antibody raised against the N terminal of UBD |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
UBD antibody |
70R-21094 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBD antibody |
UBD antibody |
38663-100ul |
SAB |
100ul |
EUR 252 |
UBD Antibody |
DF7373 |
Affbiotech |
200ul |
EUR 304 |
Description: UBD Antibody detects endogenous levels of total UBD. |
UBD Antibody |
1-CSB-PA025435GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against UBD. Recognizes UBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
UBD Antibody |
1-CSB-PA025435LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
UBD siRNA |
20-abx905902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBD siRNA |
20-abx938751 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBD siRNA |
20-abx938752 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin D Blocking Peptide |
33R-8192 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBD antibody, catalog no. 70R-5744 |
Ubiquitin D Conjugated Antibody |
C49304 |
SAB |
100ul |
EUR 397 |
Human UBD shRNA Plasmid |
20-abx957162 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UBD Recombinant Protein (Human) |
RP033664 |
ABM |
100 ug |
Ask for price |
Human Ubiquitin ELISA kit |
E01U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ubiquitin ELISA kit |
E01U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ubiquitin ELISA kit |
E01U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
UBD Rabbit pAb |
A13397-100ul |
Abclonal |
100 ul |
EUR 308 |
UBD Rabbit pAb |
A13397-200ul |
Abclonal |
200 ul |
EUR 459 |
UBD Rabbit pAb |
A13397-20ul |
Abclonal |
20 ul |
EUR 183 |
UBD Rabbit pAb |
A13397-50ul |
Abclonal |
50 ul |
EUR 223 |
UBD Blocking Peptide |
DF7373-BP |
Affbiotech |
1mg |
EUR 195 |
Polyclonal UBD Antibody |
APR11237G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBD . This antibody is tested and proven to work in the following applications: |
UBD Conjugated Antibody |
C38663 |
SAB |
100ul |
EUR 397 |
UBD cloning plasmid |
CSB-CL025435HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 498
- Sequence: atggctcccaatgcttcctgcctctgtgtgcatgtccgttccgaggaatgggatttaatgacctttgatgccaacccatatgacagcgtgaaaaaaatcaaagaacatgtccggtctaagaccaaggttcctgtgcaggaccaggttcttttgctgggctccaagatcttaaagcc
- Show more
|
Description: A cloning plasmid for the UBD gene. |
UBD Polyclonal Antibody |
A50572 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
UBD Rabbit pAb |
A5491-100ul |
Abclonal |
100 ul |
EUR 308 |
UBD Rabbit pAb |
A5491-200ul |
Abclonal |
200 ul |
EUR 459 |
UBD Rabbit pAb |
A5491-20ul |
Abclonal |
20 ul |
EUR 183 |
UBD Rabbit pAb |
A5491-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- UBD antibody |
FNab09160 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200
- Immunogen: ubiquitin D
- Uniprot ID: O15205
- Gene ID: 10537
|
Description: Antibody raised against UBD |
UBD ORF Vector (Human) (pORF) |
ORF011222 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human Ubiquitin,Ub ELISA Kit |
201-12-1619 |
SunredBio |
96 tests |
EUR 440 |
- This Ubiquitin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Ubiquitin (Ub) ELISA Kit |
DLR-Ub-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids. |
Human Ubiquitin (Ub) ELISA Kit |
DLR-Ub-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids. |
Human Ubiquitin (Ub) ELISA Kit |
abx253335-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Ubiquitin,Ub ELISA Kit |
CN-04289H1 |
ChemNorm |
96T |
EUR 434 |
Human Ubiquitin,Ub ELISA Kit |
CN-04289H2 |
ChemNorm |
48T |
EUR 284 |
Human Ubiquitin (Ub) ELISA Kit |
RDR-Ub-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Ubiquitin (Ub) ELISA Kit |
RDR-Ub-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Ubiquitin (Ub) ELISA Kit |
RD-Ub-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Ubiquitin (Ub) ELISA Kit |
RD-Ub-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Anti-Ubiquitin D Rabbit Monoclonal Antibody |
M01970 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Ubiquitin D Antibody. Validated in IF, WB and tested in Human, Mouse. |
14,15-DHET Human Urine ELISA Kit |
DH3 |
Detroit R&D |
1 Kit |
EUR 323 |
UBD protein (His tag) |
80R-1964 |
Fitzgerald |
10 ug |
EUR 322 |
Description: Recombinant human UBD protein (His tag) |
Anti-FAT10/UBD Antibody |
A01970-1 |
BosterBio |
100ug/vial |
EUR 294 |
Mouse UBD shRNA Plasmid |
20-abx973642 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat UBD shRNA Plasmid |
20-abx985328 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UBD Antibody, HRP conjugated |
1-CSB-PA025435LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBD Antibody, FITC conjugated |
1-CSB-PA025435LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBD Antibody, Biotin conjugated |
1-CSB-PA025435LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-Diubiquitin/UBD Antibody |
PA2222 |
BosterBio |
100ug/vial |
EUR 334 |
UBD Recombinant Protein (Rat) |
RP235514 |
ABM |
100 ug |
Ask for price |
UBD Recombinant Protein (Mouse) |
RP182609 |
ABM |
100 ug |
Ask for price |
Fmoc-D-Ala-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g) |
D-1425.0001 |
Bachem |
1.0g |
EUR 236 |
Fmoc-D-Ala-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g) |
D-1425.0005 |
Bachem |
5.0g |
EUR 841 |
Boc-D-Ala-PAM resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1495.0001 |
Bachem |
1.0g |
EUR 381 |
Boc-D-Ala-PAM resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1495.0005 |
Bachem |
5.0g |
EUR 1421 |
Boc-D-Asn-PAM resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1570.0001 |
Bachem |
1.0g |
EUR 122 |
Boc-D-Asn-PAM resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1570.0005 |
Bachem |
5.0g |
EUR 381 |
Fmoc-D-Leu-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1765.0001 |
Bachem |
1.0g |
EUR 261 |
Fmoc-D-Leu-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1765.0005 |
Bachem |
5.0g |
EUR 925 |
Fmoc-D-Phe-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1770.0001 |
Bachem |
1.0g |
EUR 261 |
Fmoc-D-Phe-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1770.0005 |
Bachem |
5.0g |
EUR 925 |
Fmoc-D-Val-Wang resin (200-400 mesh, 0.6-0.9 mmol/g) |
D-2465.0001 |
Bachem |
1.0g |
EUR 176 |
Fmoc-D-Val-Wang resin (200-400 mesh, 0.6-0.9 mmol/g) |
D-2465.0005 |
Bachem |
5.0g |
EUR 611 |
Fmoc-D-Leu-Wang resin (200-400 mesh, 0.50-1.00 mmol/g) |
D-2535.0001 |
Bachem |
1.0g |
EUR 151 |
Fmoc-D-Leu-Wang resin (200-400 mesh, 0.50-1.00 mmol/g) |
D-2535.0005 |
Bachem |
5.0g |
EUR 515 |
Fmoc-D-Val-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g) |
D-2690.0001 |
Bachem |
1.0g |
EUR 145 |
Fmoc-D-Val-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g) |
D-2690.0005 |
Bachem |
5.0g |
EUR 477 |
UBD sgRNA CRISPR Lentivector set (Human) |
K2570101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human cathepsin D,cath-D ELISA Kit |
201-12-0865 |
SunredBio |
96 tests |
EUR 440 |
- This cathepsin D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human cathepsin D,cath-D ELISA Kit |
CN-04595H1 |
ChemNorm |
96T |
EUR 447 |
Human cathepsin D,cath-D ELISA Kit |
CN-04595H2 |
ChemNorm |
48T |
EUR 296 |
Human cathepsin D, cath-D ELISA Kit |
CSB-E09221h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human cathepsin D, cath-D in samples from serum, plasma, tissue homogenates, asciticfluid. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human cathepsin D, cath-D ELISA Kit |
1-CSB-E09221h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human cathepsin D, cath-D in samples from serum, plasma, tissue homogenates, asciticfluid. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Rat Ubiquitin ELISA kit |
E02U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ubiquitin ELISA kit |
E02U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ubiquitin ELISA kit |
E02U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Ubiquitin ELISA kit |
E04U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Ubiquitin ELISA kit |
E04U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Ubiquitin ELISA kit |
E04U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ubiquitin ELISA kit |
E03U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ubiquitin ELISA kit |
E03U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ubiquitin ELISA kit |
E03U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Ubiquitin (Ub) ELISA Kit |
20-abx153546 |
Abbexa |
-
EUR 6971.00
-
EUR 3714.00
-
EUR 864.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Pig Ubiquitin ELISA kit |
E07U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Ubiquitin ELISA kit |
E07U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Ubiquitin ELISA kit |
E07U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Ubiquitin ELISA kit |
E08U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Ubiquitin ELISA kit |
E08U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Ubiquitin ELISA kit |
E08U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Ubiquitin ELISA kit |
E09U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Ubiquitin ELISA kit |
E09U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Ubiquitin ELISA kit |
E09U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Ubiquitin ELISA kit |
E06U0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Ubiquitin ELISA kit |
E06U0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Ubiquitin ELISA kit |
E06U0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Ubiquitin (Ub) ELISA Kit |
20-abx576016 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Fmoc-D-Arg(Pmc)-Wang resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1560.0001 |
Bachem |
1.0g |
EUR 261 |
Fmoc-D-Arg(Pmc)-Wang resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1560.0005 |
Bachem |
5.0g |
EUR 961 |
Fmoc-D-Glu(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1775.0001 |
Bachem |
1.0g |
EUR 170 |
Fmoc-D-Glu(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1775.0005 |
Bachem |
5.0g |
EUR 587 |
Fmoc-D-Asn(Trt)-SASRIN resin (200-400 mesh, 0.3-0.6 mmol/g) |
D-1780.0001 |
Bachem |
1.0g |
EUR 454 |
Fmoc-D-Asn(Trt)-SASRIN resin (200-400 mesh, 0.3-0.6 mmol/g) |
D-1780.0005 |
Bachem |
5.0g |
EUR 1698 |
Fmoc-D-Lys(Boc)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1785.0001 |
Bachem |
1.0g |
EUR 309 |
Fmoc-D-Lys(Boc)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1785.0005 |
Bachem |
5.0g |
EUR 1143 |
Fmoc-D-Pen(Trt)-Wang resin (200-400 mesh, 0.25-0.55 mmol/g) |
D-1870.0001 |
Bachem |
1.0g |
EUR 381 |
Fmoc-D-Pen(Trt)-Wang resin (200-400 mesh, 0.25-0.55 mmol/g) |
D-1870.0005 |
Bachem |
5.0g |
EUR 1421 |
Fmoc-D-Trp(Boc)-Wang resin (200-400 mesh, 0.5-0.8 mmol/g) |
D-1905.0001 |
Bachem |
1.0g |
EUR 261 |
Fmoc-D-Trp(Boc)-Wang resin (200-400 mesh, 0.5-0.8 mmol/g) |
D-1905.0005 |
Bachem |
5.0g |
EUR 925 |
Fmoc-D-Cys(Trt)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1985.0001 |
Bachem |
1.0g |
EUR 454 |
Fmoc-D-Cys(Trt)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-1985.0005 |
Bachem |
5.0g |
EUR 1698 |
Fmoc-D-Arg(Pbf)-Wang resin (200-400 mesh, 0.50-1.00 mmol/g) |
D-1995.0001 |
Bachem |
1.0g |
EUR 334 |
Fmoc-D-Arg(Pbf)-Wang resin (200-400 mesh, 0.50-1.00 mmol/g) |
D-1995.0005 |
Bachem |
5.0g |
EUR 1251 |
Fmoc-D-Asp(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-2680.0001 |
Bachem |
1.0g |
EUR 309 |
Fmoc-D-Asp(OtBu)-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-2680.0005 |
Bachem |
5.0g |
EUR 1143 |
H-D-Val-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g) |
D-2990.0001 |
Bachem |
1.0g |
EUR 265 |
H-D-Val-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g) |
D-2990.0005 |
Bachem |
5.0g |
EUR 970 |
ELISA kit for Human Ub (Ubiquitin) |
E-EL-H1252 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's Ub ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ub. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human Ub (Ubiquitin) in samples from Serum, Plasma, Cell supernatant |
Human ubiquitin B (UBB) ELISA kit |
CSB-EL025429HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin B (UBB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human ubiquitin B (UBB) ELISA kit |
1-CSB-EL025429HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin B (UBB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human ubiquitin C (UBC) ELISA kit |
CSB-EL025434HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin C (UBC) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human ubiquitin C (UBC) ELISA kit |
1-CSB-EL025434HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin C (UBC) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human ubiquitin B (UBB) ELISA kit |
E01U0044-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ubiquitin B (UBB) ELISA kit |
E01U0044-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ubiquitin B (UBB) ELISA kit |
E01U0044-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Ub (Ubiquitin) |
ELK5287 |
ELK Biotech |
1 plate of 96 wells |
EUR 372 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ubiquitin (Ub). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ubiquitin (Ub). Nex
- Show more
|
Description: A sandwich ELISA kit for detection of Ubiquitin from Human,Mouse,Rat,Rabbit,Dog,Pig,Cattle,Horse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Fmoc-D-His(1-Trt)-SASRIN resin (200-400 mesh, 0.2-0.5 mmol/g) |
D-1980.0001 |
Bachem |
1.0g |
EUR 244 |
Fmoc-D-His(1-Trt)-SASRIN resin (200-400 mesh, 0.2-0.5 mmol/g) |
D-1980.0005 |
Bachem |
5.0g |
EUR 866 |
H-D-Arg(Pbf)-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g) |
D-2940.0001 |
Bachem |
1.0g |
EUR 265 |
H-D-Arg(Pbf)-2-chlorotrityl resin (200-400 mesh, 0.50-0.90 mmol/g) |
D-2940.0005 |
Bachem |
5.0g |
EUR 970 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
H-D-Cys(4-methoxytrityl)-2-chlorotrityl resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-2485.0001 |
Bachem |
1.0g |
EUR 309 |
H-D-Cys(4-methoxytrityl)-2-chlorotrityl resin (200-400 mesh, 0.4-0.7 mmol/g) |
D-2485.0005 |
Bachem |
5.0g |
EUR 1143 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-100ug |
QP6862-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-10ug |
QP6862-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-1mg |
QP6862-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-200ug |
QP6862-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-500ug |
QP6862-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Ubiquitin D Protein, His-SUMO, E.coli-50ug |
QP6862-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Human D-Lactate Dehydrogenase,D-LDH ELISA Kit |
201-12-0753 |
SunredBio |
96 tests |
EUR 440 |
- This D-Lactate Dehydrogenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Surfactant Protein D,SP-D ELISA Kit |
201-12-1075 |
SunredBio |
96 tests |
EUR 440 |
- This Surfactant Protein D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human D-Lactate Dehydrogenase, D-LDH ELISA Kit |
CSB-E11720h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human D-Lactate Dehydrogenase, D-LDH in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human D-Lactate Dehydrogenase, D-LDH ELISA Kit |
1-CSB-E11720h |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human D-Lactate Dehydrogenase, D-LDH in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Surfactant Protein D,SP-D ELISA Kit |
CN-04385H1 |
ChemNorm |
96T |
EUR 457 |
Human Surfactant Protein D,SP-D ELISA Kit |
CN-04385H2 |
ChemNorm |
48T |
EUR 306 |
Human D-Lactate Dehydrogenase(D-LDH)ELISA Kit |
GA-E0769HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human D-Lactate Dehydrogenase(D-LDH)ELISA Kit |
GA-E0769HM-96T |
GenAsia Biotech |
96T |
EUR 466 |