Human IL26(Interleukin 26) ELISA Kit

Human IL26(Interleukin 26) ELISA Kit

To Order Contact us: [email protected]

Human Interleukin 26 (IL26) ELISA Kit
RDR-IL26-Hu-96Tests 96 Tests
EUR 633
Human Interleukin-26 (IL26)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-26(IL26) expressed in Yeast
Human Interleukin-26 (IL26)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-26 (IL26) expressed in E.coli
Human Interleukin 26 (IL26) ELISA Kit
abx574507-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human IL26/ Interleukin-26 ELISA Kit
E1284Hu 1 Kit
EUR 571
Human Interleukin- 26, IL26 ELISA KIT
ELI-05519h 96 Tests
EUR 824
Human Interleukin 26 (IL26) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Interleukin 26 (IL26) ELISA Kit
abx251204-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Interleukin 26 (IL26) ELISA Kit
SEB695Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26) ELISA Kit
SEB695Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26) ELISA Kit
SEB695Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26) ELISA Kit
SEB695Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 26 elisa. Alternative names of the recognized antigen: AK155
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 26 (IL26) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Interleukin 26 ELISA Kit (IL26)
RK01672 96 Tests
EUR 521
Interleukin 26 (IL26) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Interleukin 26 (IL26) Antibody
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Interleukin 26 (IL26) Antibody
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Interleukin 26 (IL26) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Interleukin 26 (IL26) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Interleukin 26 (IL26)
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NPH9
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.5kDa
  • Isoelectric Point: 9.8
Description: Recombinant Human Interleukin 26 expressed in: E.coli
ELISA kit for Human IL26 (Interleukin 26)
ELK2152 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 26 (IL26). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 26 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Interleukin 26 (IL26) CLIA Kit
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Interleukin 26 (IL26)CLIA Kit
SCB695Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26)CLIA Kit
SCB695Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26)CLIA Kit
SCB695Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26)CLIA Kit
SCB695Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Interleukin 26 (IL26) CLIA Kit
  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 26 Clia kit. Alternative names of the recognized antigen: AK155
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26)Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids
Human Interleukin 26 (IL26) Protein (Active)
  • EUR 1149.00
  • EUR 411.00
  • EUR 3850.00
  • EUR 1400.00
  • EUR 787.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit
MEB695Mu-10x96wellstestplate 10x96-wells test plate
EUR 5523.45
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).
Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit
MEB695Mu-1x48wellstestplate 1x48-wells test plate
EUR 542.52
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).
Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit
MEB695Mu-1x96wellstestplate 1x96-wells test plate
EUR 732.17
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).
Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit
MEB695Mu-5x96wellstestplate 5x96-wells test plate
EUR 2994.77
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).
Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit
  • EUR 5574.00
  • EUR 2945.00
  • EUR 733.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 26 elisa. Alternative names of the recognized antigen: AK155
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 26 (IL26) in samples from n/a with no significant corss-reactivity with analogues from other species.
Human IL-26(Interleukin-26) ELISA Kit
EH1888 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q9NPH9
  • Alias: IL26/Interleukin-26/IL-26/Protein AK155/AK155/interleukin 26
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml
Human Interleukin 26(IL-26)ELISA Kit
GA-E0093HM-48T 48T
EUR 289
Human Interleukin 26(IL-26)ELISA Kit
GA-E0093HM-96T 96T
EUR 466
Human Interleukin 26,IL-26 ELISA Kit
201-12-0054 96 tests
EUR 440
  • This Interleukin 26 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Interleukin 26, IL-26 ELISA Kit
CSB-E11716h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 26, IL-26 in samples from serum, urine, tissue homogenates, cell lysates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Interleukin 26, IL-26 ELISA Kit
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 26, IL-26 in samples from serum, urine, tissue homogenates, cell lysates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Interleukin 26(IL-26)ELISA Kit
QY-E04285 96T
EUR 361
Human Interleukin 26 ELISA kit
E01I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Interleukin 26 ELISA kit
E01I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Interleukin 26 ELISA kit
E01I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human IL-26 (Interleukin 26)
E-EL-H2580 1 plate of 96 wells
EUR 534
  • Gentaur's IL-26 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-26. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-26 (Interleukin 26) in samples from Serum, Plasma, Cell supernatant
IL-15, Interleukin-15, human
RC212-26 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
ELISA kit for Human Interleukin-26
EK3882 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-26 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human IL26 ELISA Kit
ELA-E1695h 96 Tests
EUR 824
EF006005 96 Tests
EUR 689
Human IL26 ELISA kit
55R-2186 96 tests
EUR 766
Description: ELISA Kit for detection of IL26 in the research laboratory
Goat Interleukin 26 ELISA kit
E06I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Interleukin 26 ELISA kit
E06I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Interleukin 26 ELISA kit
E06I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Interleukin 26 ELISA kit
E02I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Interleukin 26 ELISA kit
E02I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Interleukin 26 ELISA kit
E02I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Interleukin 26 ELISA kit
E03I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Interleukin 26 ELISA kit
E03I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Interleukin 26 ELISA kit
E03I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Interleukin 26 ELISA kit
E04I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Interleukin 26 ELISA kit
E04I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Interleukin 26 ELISA kit
E04I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Interleukin 26 ELISA kit
E08I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Interleukin 26 ELISA kit
E08I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Interleukin 26 ELISA kit
E08I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Interleukin 26 ELISA kit
E07I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Interleukin 26 ELISA kit
E07I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Interleukin 26 ELISA kit
E07I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Interleukin 26 ELISA kit
E09I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Interleukin 26 ELISA kit
E09I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Interleukin 26 ELISA kit
E09I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
IL26 ELISA Kit (Human) (OKAN05753)
OKAN05753 96 Wells
EUR 792
Description: Description of target: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL
IL26 ELISA Kit (Human) (OKCD07603)
OKCD07603 96 Wells
EUR 936
Description: Description of target: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL
IL26 ELISA Kit (Human) (OKEH01219)
OKEH01219 96 Wells
EUR 662
Description: Description of target: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL
Guinea pig Interleukin 26 ELISA kit
E05I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Interleukin 26 ELISA kit
E05I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Interleukin 26 ELISA kit
E05I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ICA (Anti-insulin cell antibody) ELISA test
26 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of ICA (Anti-insulin cell antibody)
Human IL26 Protein
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
IL26 Chemi-Luminescent ELISA Kit (Human) (OKCD03662)
OKCD03662 96 Wells
EUR 988
Description: Description of target: May play a role in local mechanisms of mucosal immunity and seems to have a proinflammatory function. May play a role in inflammatory bowel disease. Activates STAT1 and STAT3, MAPK1/3 (ERK1/2), JUN and AKT. Induces expression of SOCS3, TNF-alpha and IL-8, secretion of IL-8 and IL-10 and surface expression of ICAM1. Decreases proliferation of intestinal epithelial cells. Is inhibited by heparin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.37 pg/mL
IL26 Antibody
ABD8983 100 ug
EUR 438
IL26 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
IL26 Antibody
45630-100ul 100ul
EUR 252
IL26 Antibody
45630-50ul 50ul
EUR 187
IL26 Antibody
DF8983 200ul
EUR 304
Description: IL26 Antibody detects endogenous levels of total IL26.
IL26 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IL26. Recognizes IL26 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
PVT17692 2 ug
EUR 258
Human Matrix Metalloproteinase 26(MMP-26)ELISA Kit
QY-E02986 96T
EUR 361
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human IL26 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Connexin 26 ELISA kit
E01C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Connexin 26 ELISA kit
E01C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Connexin 26 ELISA kit
E01C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
MMP-26/ Rat MMP- 26 ELISA Kit
ELA-E1256r 96 Tests
EUR 886
IL26 Conjugated Antibody
C45630 100ul
EUR 397
IL26 Rabbit pAb
A17729-100ul 100 ul
EUR 308
IL26 Rabbit pAb
A17729-200ul 200 ul
EUR 459
IL26 Rabbit pAb
A17729-20ul 20 ul
EUR 183
IL26 Rabbit pAb
A17729-50ul 50 ul
EUR 223
IL26 cloning plasmid
CSB-CL873613HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 516
  • Sequence: atgctggtgaatttcattttgaggtgtgggttgctgttagtcactctgtctcttgccattgccaagcacaagcaatcttccttcaccaaaagttgttacccaaggggaacattgtcccaagctgttgacgctctctatatcaaagcagcatggctcaaagcaacgattccagaaga
  • Show more
Description: A cloning plasmid for the IL26 gene.
IL26 cloning plasmid
CSB-CL873613HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 516
  • Sequence: atgctggtgaatttcattttgaggtgtgggttgctgttagtcactctgtctcttgccattgccaagcacaagcaatcttccttcaccaaaagttgttacccaaggggaacattgtcccaagctgttgacgctctctatatcaaagcagcatggctcaaagcaacgattccagaaga
  • Show more
Description: A cloning plasmid for the IL26 gene.
IL26 Blocking Peptide
DF8983-BP 1mg
EUR 195
pET3a-IL26 Plasmid
PVTB00087-1d 2 ug
EUR 356
Anti-IL26 antibody
STJ119771 100 µl
EUR 277
Description: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri. [provided by RefSeq, Jul 2008]
Anti-IL26 (2A8)
YF-MA18835 100 ug
EUR 363
Description: Mouse monoclonal to IL26
HCMV Interleukin 10 (aa 26 - 176)
DAG2590 25 ug
EUR 901
EBV Interleukin 10 (aa 26 - 170)
DAG2652 10 µg
EUR 901
IL26 ORF Vector (Human) (pORF)
ORF005343 1.0 ug DNA
EUR 95
IL26 ORF Vector (Human) (pORF)
ORF005344 1.0 ug DNA
EUR 95
Recombinant Human Interleukin-26 Protein, His, Yeast-100ug
QP9904-ye-100ug 100ug
EUR 480
Recombinant Human Interleukin-26 Protein, His, Yeast-10ug
QP9904-ye-10ug 10ug
EUR 236
Recombinant Human Interleukin-26 Protein, His, Yeast-1mg
QP9904-ye-1mg 1mg
EUR 1885
Recombinant Human Interleukin-26 Protein, His, Yeast-200ug
QP9904-ye-200ug 200ug
EUR 744
Recombinant Human Interleukin-26 Protein, His, Yeast-500ug
QP9904-ye-500ug 500ug
EUR 1206
Recombinant Human Interleukin-26 Protein, His, Yeast-50ug
QP9904-ye-50ug 50ug
EUR 299
MANF, human
RC218-26 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Neurotrophins
Human CX26(Connexin 26) ELISA Kit
EH2905 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P29033
  • Alias: CX26/Connexin 26/GJB2/Connexin-26/DFNB1/DFNA3A/Gap junction beta 2 protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Cadherin 26 (CDH26) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Connexin 26 (CX26) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Cadherin 26 (CDH26) ELISA Kit
DLR-CDH26-Hu-48T 48T
EUR 554
  • Should the Human Cadherin 26 (CDH26) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cadherin 26 (CDH26) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Cadherin 26 (CDH26) ELISA Kit
DLR-CDH26-Hu-96T 96T
EUR 725
  • Should the Human Cadherin 26 (CDH26) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cadherin 26 (CDH26) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
DLR-CX26-Hu-48T 48T
EUR 498
  • Should the Human Connexin 26 (CX26) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Connexin 26 (CX26) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
DLR-CX26-Hu-96T 96T
EUR 647
  • Should the Human Connexin 26 (CX26) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Connexin 26 (CX26) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
SEB471Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 26 (CX26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 26 (CX26) in serum, plasma, tissue homogenates and other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
SEB471Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 26 (CX26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 26 (CX26) in serum, plasma, tissue homogenates and other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
SEB471Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 26 (CX26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 26 (CX26) in serum, plasma, tissue homogenates and other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
SEB471Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 26 (CX26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 26 (CX26) in serum, plasma, tissue homogenates and other biological fluids.
Human Connexin 26 (CX26) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Connexin 26 elisa. Alternative names of the recognized antigen: KID
  • DFNA3
  • DFNB1
  • HID
  • NSRD1
  • PPK
  • GJB2
  • Gap Junction Protein Beta 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Connexin 26 (CX26) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Cadherin 26 (CDH26) ELISA Kit
RD-CDH26-Hu-48Tests 48 Tests
EUR 563
Human Cadherin 26 (CDH26) ELISA Kit
RD-CDH26-Hu-96Tests 96 Tests
EUR 783
Human Cadherin 26 (CDH26) ELISA Kit
RDR-CDH26-Hu-48Tests 48 Tests
EUR 589
Human Cadherin 26 (CDH26) ELISA Kit
RDR-CDH26-Hu-96Tests 96 Tests
EUR 820
Human Connexin 26 (CX26) ELISA Kit
RDR-CX26-Hu-48Tests 48 Tests
EUR 522
Human Connexin 26 (CX26) ELISA Kit
RDR-CX26-Hu-96Tests 96 Tests
EUR 724
Human Connexin 26 (CX26) ELISA Kit
RD-CX26-Hu-48Tests 48 Tests
EUR 500
Human Connexin 26 (CX26) ELISA Kit
RD-CX26-Hu-96Tests 96 Tests
EUR 692
Human Connexin 26(CX26)ELISA Kit
QY-E02880 96T
EUR 361
Human Cadherin 26(CDH26)ELISA Kit
QY-E03479 96T
EUR 361
Human Cadherin 26 (CDH26) ELISA Kit
SEQ485Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 26 (CDH26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 26 (CDH26) in Tissue homogenates, cell lysates and other biological fluids.
Human Cadherin 26 (CDH26) ELISA Kit
SEQ485Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 26 (CDH26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 26 (CDH26) in Tissue homogenates, cell lysates and other biological fluids.
Human Cadherin 26 (CDH26) ELISA Kit
SEQ485Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 26 (CDH26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 26 (CDH26) in Tissue homogenates, cell lysates and other biological fluids.
Human Cadherin 26 (CDH26) ELISA Kit
SEQ485Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 26 (CDH26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 26 (CDH26) in Tissue homogenates, cell lysates and other biological fluids.
Human Cadherin 26 (CDH26) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cadherin 26 elisa. Alternative names of the recognized antigen: VR20
  • Cadherin-like protein 26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cadherin 26 (CDH26) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
MIP-5, CCL15, human
RC315-26 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
TFF2, Trefoil Factor 2, human
RC712-26 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Other
pE-SUMO-IL26 Plasmid
PVTB00087-1c 2 ug
EUR 356
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
IL26 sgRNA CRISPR Lentivector set (Human)
K1082601 3 x 1.0 ug
EUR 339
Goat Connexin 26 ELISA kit
E06C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Connexin 26 ELISA kit
E06C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Connexin 26 ELISA kit
E06C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Connexin 26 ELISA kit
E02C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Connexin 26 ELISA kit
E02C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Connexin 26 ELISA kit
E02C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Connexin 26 ELISA kit
E03C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Connexin 26 ELISA kit
E03C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Connexin 26 ELISA kit
E03C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Connexin 26 ELISA kit
E04C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Connexin 26 ELISA kit
E04C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Connexin 26 ELISA kit
E04C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Connexin 26 ELISA kit
E07C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Connexin 26 ELISA kit
E07C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Connexin 26 ELISA kit
E07C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Connexin 26 ELISA kit
E08C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Connexin 26 ELISA kit
E08C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Connexin 26 ELISA kit
E08C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Connexin 26 ELISA kit
E09C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Connexin 26 ELISA kit
E09C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Connexin 26 ELISA kit
E09C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
abx570156-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Human Matrix metalloproteinase-26
EK3066 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Matrix metalloproteinase-26 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human MMP26/ Matrix metalloproteinase-26 ELISA Kit
E1618Hu 1 Kit
EUR 571
Human MMP26(Matrix metalloproteinase-26) ELISA Kit
EH1432 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9NRE1
  • Alias: MMP26/Matrix metalloproteinase-26/MMP-26/Endometase/Matrilysin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Transmembrane protein 26, TMEM26 ELISA KIT
ELI-22980h 96 Tests
EUR 824
Human Matrix metalloproteinase- 26, MMP26 ELISA KIT
ELI-04156h 96 Tests
EUR 824
ELISA kit for Human CDH26 (Cadherin 26)
ELK6683 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cadherin 26 (CDH26). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cadherin 26 (C
  • Show more
Description: A sandwich ELISA kit for detection of Cadherin 26 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human CX26 (Connexin 26)
ELK1940 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Connexin 26 (CX26). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Connexin 26 (CX
  • Show more
Description: A sandwich ELISA kit for detection of Connexin 26 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
abx250709-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
DLR-MMP26-Hu-48T 48T
EUR 498
  • Should the Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Metalloproteinase 26 (MMP26) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
DLR-MMP26-Hu-96T 96T
EUR 647
  • Should the Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Metalloproteinase 26 (MMP26) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Matrix metalloproteinase-26(MMP26) ELISA kit
CSB-EL014673HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase-26 (MMP26) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Matrix metalloproteinase-26(MMP26) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase-26(MMP26) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
ELISA kit for Human CX26 (Connexin 26)
E-EL-H0830 1 plate of 96 wells
EUR 534
  • Gentaur's CX26 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CX26. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CX26 (Connexin 26) in samples from Serum, Plasma, Cell supernatant
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
SEB256Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Metalloproteinase 26 (MMP26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Metalloproteinase 26 (MMP26) in tissue homogenates, cell lysates and other biological fluids.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
SEB256Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Metalloproteinase 26 (MMP26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Metalloproteinase 26 (MMP26) in tissue homogenates, cell lysates and other biological fluids.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
SEB256Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Metalloproteinase 26 (MMP26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Metalloproteinase 26 (MMP26) in tissue homogenates, cell lysates and other biological fluids.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
SEB256Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Metalloproteinase 26 (MMP26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Metalloproteinase 26 (MMP26) in tissue homogenates, cell lysates and other biological fluids.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrix Metalloproteinase 26 elisa. Alternative names of the recognized antigen: Matrilysin-2
  • Endometase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrix Metalloproteinase 26 (MMP26) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
RD-MMP26-Hu-48Tests 48 Tests
EUR 500
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
RD-MMP26-Hu-96Tests 96 Tests
EUR 692
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
RDR-MMP26-Hu-48Tests 48 Tests
EUR 522
Human Matrix Metalloproteinase 26 (MMP26) ELISA Kit
RDR-MMP26-Hu-96Tests 96 Tests
EUR 724
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Recombinant HCMV Interleukin 10 Protein (aa 26-176)
VAng-Lsx0197-inquire inquire Ask for price
Description: HCMV Interleukin 10 (aa 26-176), recombinant protein from E. coli.
IL26 sgRNA CRISPR Lentivector (Human) (Target 1)
K1082602 1.0 ug DNA
EUR 154
IL26 sgRNA CRISPR Lentivector (Human) (Target 2)
K1082603 1.0 ug DNA
EUR 154
IL26 sgRNA CRISPR Lentivector (Human) (Target 3)
K1082604 1.0 ug DNA
EUR 154
IL26 Protein Vector (Human) (pPB-C-His)
PV021369 500 ng
EUR 329
IL26 Protein Vector (Human) (pPB-N-His)
PV021370 500 ng
EUR 329
IL26 Protein Vector (Human) (pPM-C-HA)
PV021371 500 ng
EUR 329
IL26 Protein Vector (Human) (pPM-C-His)
PV021372 500 ng
EUR 329
IL26 Protein Vector (Human) (pPB-C-His)
PV021373 500 ng
EUR 329
IL26 Protein Vector (Human) (pPB-N-His)
PV021374 500 ng
EUR 329
IL26 Protein Vector (Human) (pPM-C-HA)
PV021375 500 ng
EUR 329
IL26 Protein Vector (Human) (pPM-C-His)
PV021376 500 ng
EUR 329
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Guinea pig Connexin 26 ELISA kit
E05C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Connexin 26 ELISA kit
E05C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Connexin 26 ELISA kit
E05C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CX26(Connexin 26) ELISA Kit
ER0879 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P21994
  • Alias: CX26/GJB2/Connexin-26/DFNB1/DFNA3A/Gap junction beta 2 protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml
Mouse CX26(Connexin 26) ELISA Kit
EM0962 96T
EUR 524.1
  • Detection range: 19.531-1250 pg/ml
  • Uniprot ID: Q00977
  • Alias: CX26
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 11.719pg/ml
CX26 ELISA Kit| Rat Connexin 26 ELISA Kit
EF017663 96 Tests
EUR 689
CX26 ELISA Kit| Mouse Connexin 26 ELISA Kit
EF013547 96 Tests
EUR 689
Human Cadherin like protein 26(CDH26) ELISA kit
E01C1545-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cadherin like protein 26(CDH26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cadherin like protein 26(CDH26) ELISA kit
E01C1545-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cadherin like protein 26(CDH26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cadherin like protein 26(CDH26) ELISA kit
E01C1545-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cadherin like protein 26(CDH26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human RNA- binding protein 26, RBM26 ELISA KIT
ELI-19533h 96 Tests
EUR 824
Human Sterol 26- hydroxylase, mitochondrial, CYP27A1 ELISA KIT
ELI-25574h 96 Tests
EUR 824
Human RING finger protein 26, RNF26 ELISA KIT
ELI-52813h 96 Tests
EUR 824
ELISA kit for Human MMP26 (Matrix Metalloproteinase 26)
ELK1831 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrix Metalloproteinase 26 (MMP26). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Matrix Metalloproteinase 26 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Peroxisome assembly protein 26, PEX26 ELISA KIT
ELI-37351h 96 Tests
EUR 824
Human Zinc finger protein 26, ZNF26 ELISA KIT
ELI-40752h 96 Tests
EUR 824
Human Kelch- like protein 26, KLHL26 ELISA KIT
ELI-47855h 96 Tests
EUR 824
Human Cadherin- like protein 26, CDH26 ELISA KIT
ELI-49270h 96 Tests
EUR 824
Human Tetratricopeptide repeat protein 26, TTC26 ELISA KIT
ELI-51064h 96 Tests
EUR 824
Human Mediator Complex Subunit 26 (MED26) ELISA Kit
abx381398-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Ring Finger Protein 26 (RNF26) ELISA Kit
abx382856-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Tetratricopeptide Repeat Domain 26 (TTC26) ELISA Kit
abx384008-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Ankyrin Repeat Domain 26 (ANKRD26) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
ELISA kit for Human Matrix metalloproteinase-26 (MMP26)
KTE61590-48T 48T
EUR 332
  • Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrix metalloproteinase-26 (MMP26) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrix metalloproteinase-26 (MMP26)
KTE61590-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrix metalloproteinase-26 (MMP26) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrix metalloproteinase-26 (MMP26)
KTE61590-96T 96T
EUR 539
  • Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrix metalloproteinase-26 (MMP26) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Scroll to Top