Human OIT3(Oncoprotein Induced Transcript 3) ELISA Kit

Human OIT3(Oncoprotein Induced Transcript 3) ELISA Kit

To Order Contact us: [email protected]

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
RD-OIT3-Hu-48Tests 48 Tests
EUR 500
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
RD-OIT3-Hu-96Tests 96 Tests
EUR 692
Oncoprotein Induced Transcript 3 (OIT3) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Oncoprotein Induced Transcript 3 (OIT3) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Oncoprotein Induced Transcript 3 (OIT3) Antibody
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Oncoprotein Induced Transcript 3 (OIT3)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWZ8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.5kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Oncoprotein Induced Transcript 3 expressed in: E.coli
Recombinant Oncoprotein Induced Transcript 3 (OIT3)
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6V0K7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Oncoprotein Induced Transcript 3 expressed in: E.coli
human oncoprotein induced transcript 3,OIT3 ELISA Kit
201-12-1685 96 tests
EUR 440
  • This oncoprotein induced transcript 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx054228-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx251220-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human oncoprotein induced transcript 3(OIT3)ELISA Kit
GA-E1701HM-48T 48T
EUR 289
Human oncoprotein induced transcript 3(OIT3)ELISA Kit
GA-E1701HM-96T 96T
EUR 466
Human oncoprotein induced transcript 3(OIT3)ELISA Kit
QY-E04362 96T
EUR 361
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Oncoprotein Induced Transcript 3 elisa. Alternative names of the recognized antigen: LZP
  • Liver-specific zona pellucida domain-containing protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Oncoprotein Induced Transcript 3 (OIT3) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Monkey Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx359276-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx361216-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx362383-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx352919-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx353817-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Chicken Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx357030-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Oncoprotein Induced Transcript 3 (OIT3) CLIA Kit
abx197375-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Oncoprotein Induced Transcript 3 (OIT3) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human OIT3 (Oncoprotein Induced Transcript 3)
E-EL-H1017 1 plate of 96 wells
EUR 534
  • Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OIT3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant
Human OIT3/ Oncoprotein-induced transcript 3 protein ELISA Kit
E1825Hu 1 Kit
EUR 571
Human OIT3(Oncoprotein-induced transcript 3 protein) ELISA Kit
EH1902 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q8WWZ8
  • Alias: OIT3(Oncoprotein Induced Transcript 3)/LZP/Liver-specific zona pellucida domain-containing protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Oncoprotein- induced transcript 3 protein, OIT3 ELISA KIT
ELI-05609h 96 Tests
EUR 824
ELISA kit for Human OIT3 (Oncoprotein Induced Transcript 3)
ELK2163 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Oncoprotein Induced Transcript 3 (OIT3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif
  • Show more
Description: A sandwich ELISA kit for detection of Oncoprotein Induced Transcript 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx572145-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Oncoprotein Induced Transcript 3 (OIT3) Protein
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Mouse OIT3 (Oncoprotein Induced Transcript 3)
E-EL-M0858 1 plate of 96 wells
EUR 534
  • Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse OIT3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat OIT3 (Oncoprotein Induced Transcript 3)
E-EL-R0690 1 plate of 96 wells
EUR 534
  • Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat OIT3. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant
Mouse Oncoprotein- induced transcript 3 protein, Oit3 ELISA KIT
ELI-05607m 96 Tests
EUR 865
Bovine Oncoprotein- induced transcript 3 protein, OIT3 ELISA KIT
ELI-05610b 96 Tests
EUR 928
Guinea pig Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx357801-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Cow Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx518270-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx518272-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx518273-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
CLIA kit for Human OIT3 (Oncoprotein Induced Transcript 3)
E-CL-H0686 1 plate of 96 wells
EUR 584
  • Gentaur's OIT3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human OIT3 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse)
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3)
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3)
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), Biotinylated
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Biotin.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Cy3.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with FITC.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with HRP.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with PE.
Human Oncoprotein Induced Transcript 3 ELISA kit
E01O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Oncoprotein Induced Transcript 3 ELISA kit
E01O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Oncoprotein Induced Transcript 3 ELISA kit
E01O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Biotin.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Cy3.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with FITC.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with HRP.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with PE.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Val297~Arg506)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC-Cy7.
Rat Oncoprotein Induced Transcript 3 ELISA kit
E02O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Oncoprotein Induced Transcript 3 ELISA kit
E02O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Oncoprotein Induced Transcript 3 ELISA kit
E02O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Oncoprotein Induced Transcript 3 ELISA kit
E04O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Oncoprotein Induced Transcript 3 ELISA kit
E04O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Oncoprotein Induced Transcript 3 ELISA kit
E04O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Oncoprotein Induced Transcript 3 ELISA kit
E03O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Oncoprotein Induced Transcript 3 ELISA kit
E03O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Oncoprotein Induced Transcript 3 ELISA kit
E03O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Oncoprotein Induced Transcript 3 ELISA kit
E08O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Oncoprotein Induced Transcript 3 ELISA kit
E08O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Oncoprotein Induced Transcript 3 ELISA kit
E08O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Oncoprotein Induced Transcript 3 ELISA kit
E07O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Oncoprotein Induced Transcript 3 ELISA kit
E07O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Oncoprotein Induced Transcript 3 ELISA kit
E07O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Oncoprotein Induced Transcript 3 ELISA kit
E06O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Oncoprotein Induced Transcript 3 ELISA kit
E06O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Oncoprotein Induced Transcript 3 ELISA kit
E06O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Oncoprotein Induced Transcript 3 ELISA kit
E09O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Oncoprotein Induced Transcript 3 ELISA kit
E09O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Oncoprotein Induced Transcript 3 ELISA kit
E09O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OIT3 (Arg251~Asp524)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC-Cy7.
Guinea pig Oncoprotein Induced Transcript 3 ELISA kit
E05O0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Oncoprotein Induced Transcript 3 ELISA kit
E05O0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Oncoprotein Induced Transcript 3 ELISA kit
E05O0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Oncoprotein-induced transcript 3 protein
EK3911 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Oncoprotein-induced transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids.
Oit3/ Rat Oit3 ELISA Kit
ELI-05608r 96 Tests
EUR 886
Human OIT3 ELISA Kit
ELA-E1729h 96 Tests
EUR 824
Human OIT3 ELISA Kit
EHO0021 96Tests
EUR 521
EF006016 96 Tests
EUR 689
OIT3 ELISA Kit (Human) (OKCD07626)
OKCD07626 96 Wells
EUR 936
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.109ng/mL
OIT3 ELISA Kit (Human) (OKEH01240)
OKEH01240 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL
Bovine OIT3 ELISA Kit
EBO0021 96Tests
EUR 521
Anserini OIT3 ELISA Kit
EAO0021 96Tests
EUR 521
Chicken OIT3 ELISA Kit
ECKO0021 96Tests
EUR 521
Canine OIT3 ELISA Kit
ECO0021 96Tests
EUR 521
EGTO0021 96Tests
EUR 521
Porcine OIT3 ELISA Kit
EPO0021 96Tests
EUR 521
Sheep OIT3 ELISA Kit
ESO0021 96Tests
EUR 521
ERO0021 96Tests
EUR 521
Rabbit OIT3 ELISA Kit
ERTO0021 96Tests
EUR 521
Monkey OIT3 ELISA Kit
EMKO0021 96Tests
EUR 521
Mouse OIT3 ELISA Kit
EMO0021 96Tests
EUR 521
RAET1E Human, Retinoic Acid Early Transcript 1E Human Recombinant Protein, IgG-His Tag
PROTQ8TD07-3 Regular: 10ug
EUR 317
Description: RAET1E Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 437 amino acids (31-225 a.a.) and having a molecular mass of 49.6kDa (Molecular size on SDS-PAGE will appear at approximately 57-70kDa).;RAET1E is expressed with a 239 amino acids IgG-His tag at C-Terminus and purified by proprietary chromatographic techniques.
Glucocorticoid-Induced Transcript 1 Protein (GLCCI1) Antibody
abx027065-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Glucocorticoid-Induced Transcript 1 Protein (GLCCI1) Antibody
abx027065-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Guinea Pig OIT3 ELISA Kit
EGO0021 96Tests
EUR 521
OIT3 ELISA Kit (Mouse) (OKEI00499)
OKEI00499 96 Wells
EUR 767
Description: Description of target: May be involved in hepatocellular function and development.By similarity ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL
OIT3 ELISA Kit (Rat) (OKEI00805)
OKEI00805 96 Wells
EUR 767
Description: Description of target: May be involved in hepatocellular function and development.By similarity ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37.5 pg/mL
HPV16 E7 Oncoprotein ELISA Kit
VPK-5045 96 assays
EUR 740
HPV16 E7 Oncoprotein ELISA Kit
VPK-5045-5 5 x 96 assays
EUR 2984
HPV18 E7 Oncoprotein ELISA Kit
VPK-5046 96 assays
EUR 740
HPV18 E7 Oncoprotein ELISA Kit
VPK-5046-5 5 x 96 assays
EUR 2984
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
OIT3 Antibody
42931-100ul 100ul
EUR 252
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE60509-48T 48T
EUR 332
  • TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE60509-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE60509-96T 96T
EUR 539
  • TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human OIT3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
OIT3 Recombinant Protein (Human)
RP041842 100 ug Ask for price
OIT3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1480804 1.0 ug DNA
EUR 154
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
DLR-BAT3-Hu-48T 48T
EUR 517
  • Should the Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human HLA-B Associated Transcript 3 (BAT3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
DLR-BAT3-Hu-96T 96T
EUR 673
  • Should the Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human HLA-B Associated Transcript 3 (BAT3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Hu-48T 48T
EUR 517
  • Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Hu-96T 96T
EUR 673
  • Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
abx251801-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Trem- like transcript 3 protein, TREML3 ELISA KIT
ELI-28430h 96 Tests
EUR 824
Human HLA-B associated transcript 3 (BAT3) ELISA kit
CSB-EL002567HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human HLA-B associated transcript 3 (BAT3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human HLA-B associated transcript 3 (BAT3) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human HLA-B associated transcript 3 (BAT3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
abx572989-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human DNA Damage Inducible Transcript 3 ELISA Kit (DDIT3)
RK01255 96 Tests
EUR 521
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RDR-BAT3-Hu-48Tests 48 Tests
EUR 544
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RDR-BAT3-Hu-96Tests 96 Tests
EUR 756
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Hu-48Tests 48 Tests
EUR 544
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Hu-96Tests 96 Tests
EUR 756
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RD-BAT3-Hu-48Tests 48 Tests
EUR 521
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RD-BAT3-Hu-96Tests 96 Tests
EUR 723
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Hu-48Tests 48 Tests
EUR 521
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Hu-96Tests 96 Tests
EUR 723
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as DNA Damage Inducible Transcript 3 elisa. Alternative names of the recognized antigen: CEBPZ
  • CHOP
  • CHOP10
  • GADD153
  • C/EBP-homologous protein 10
  • CCAAT/enhancer-binding protein homologous protein
  • Growth arrest and DNA damage-inducible G
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Amphoterin induced protein 3(AMIGO3) ELISA kit
E01A1423-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Amphoterin induced protein 3(AMIGO3) ELISA kit
E01A1423-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Amphoterin induced protein 3(AMIGO3) ELISA kit
E01A1423-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Retinoic acid induced protein 3 ELISA kit
E01R0359-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Retinoic acid induced protein 3 ELISA kit
E01R0359-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Retinoic acid induced protein 3 ELISA kit
E01R0359-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Amphoterin- induced protein 3, AMIGO3 ELISA KIT
ELI-49226h 96 Tests
EUR 824
FSH (Human Follicle-stimulating hormone) ELISA test
3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)
OIT3 Conjugated Antibody
C42931 100ul
EUR 397
OIT3 cloning plasmid
CSB-CL848834HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 966
  • Sequence: atgcctccattcctgcttctcacctgcctcttcatcacaggcacctccgtgtcacccgtggccctagatccttgttctgcttacatcagcctgaatgagccctggaggaacactgaccaccagttggatgagtctcaaggtcctcctctatgtgacaaccatgtgaatggggagtg
  • Show more
Description: A cloning plasmid for the OIT3 gene.
ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE100207-48T 48T
EUR 332
  • TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE100207-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE100207-96T 96T
EUR 539
  • TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE10101-48T 48T
EUR 354
  • Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE10101-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE10101-96T 96T
EUR 572
  • Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE70368-48T 48T
EUR 332
  • TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE70368-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE70368-96T 96T
EUR 539
  • TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0529-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0529-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0529-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
OIT3 ORF Vector (Human) (pORF)
ORF013948 1.0 ug DNA
EUR 354
Recombinant Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43294
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.8kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Transforming Growth Factor Beta 1 Induced Transcript 1 expressed in: E.coli
Recombinant Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1)
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99PD6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.0kDa
  • Isoelectric Point: 8
Description: Recombinant Rat Transforming Growth Factor Beta 1 Induced Transcript 1 expressed in: E.coli
Human DDIT3/ DNA damage-inducible transcript 3 protein ELISA Kit
E0666Hu 1 Kit
EUR 605
ELISA kit for Human DNA damage-inducible transcript 3 protein
EK4899 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA damage-inducible transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids.
Human DDIT3(DNA damage-inducible transcript 3 protein) ELISA Kit
EH2438 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P35638
  • Alias: DDIT3/CEBP zeta/CHOP/CHOP10/C,EBP-homologous protein/C,EBP-homologous protein 10/CCAAT,enhancer-binding protein homologous protein/CHOP-10/CHOP10 CEBPZ/CHOPC,EBP zeta/DDIT-3/DNA damage-induc
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
ELISA kit for Human DDIT3 (DNA Damage Inducible Transcript 3)