Human OIT3(Oncoprotein Induced Transcript 3) ELISA Kit

Human OIT3(Oncoprotein Induced Transcript 3) ELISA Kit

To Order Contact us: [email protected]

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
RDR-OIT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
RDR-OIT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Oncoprotein Induced Transcript 3 (OIT3) Antibody
20-abx130349	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Oncoprotein Induced Transcript 3 (OIT3) Antibody
20-abx103361	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Oncoprotein Induced Transcript 3 (OIT3) Antibody
20-abx173889	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Recombinant Oncoprotein Induced Transcript 3 (OIT3)
4-RPB729Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8WWZ8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.5kDa Isoelectric Point: 6.7
Description: Recombinant Human Oncoprotein Induced Transcript 3 expressed in: E.coli

Recombinant Oncoprotein Induced Transcript 3 (OIT3)
4-RPB729Ra01	Cloud-Clone	EUR 528.29 EUR 244.00 EUR 1706.08 EUR 635.36 EUR 1170.72 EUR 416.00 EUR 4115.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6V0K7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Oncoprotein Induced Transcript 3 expressed in: E.coli

Human oncoprotein induced transcript 3(OIT3)ELISA Kit
GA-E1701HM-48T	GenAsia Biotech	48T	EUR 289

Human oncoprotein induced transcript 3(OIT3)ELISA Kit
GA-E1701HM-96T	GenAsia Biotech	96T	EUR 466

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
20-abx152587	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx054228-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx251220-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

human oncoprotein induced transcript 3,OIT3 ELISA Kit
201-12-1685	SunredBio	96 tests	EUR 440
This oncoprotein induced transcript 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
SEB729Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids.

Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
4-SEB729Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Oncoprotein Induced Transcript 3 elisa. Alternative names of the recognized antigen: LZP Liver-specific zona pellucida domain-containing protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human oncoprotein induced transcript 3(OIT3)ELISA Kit
QY-E04362	Qayee Biotechnology	96T	EUR 361

Human Oncoprotein Induced Transcript 3 (OIT3) Protein
20-abx068385	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pig Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx361216-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx362383-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx352919-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx353817-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx357030-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx359276-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Oncoprotein Induced Transcript 3 (OIT3) CLIA Kit
20-abx493026	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Oncoprotein Induced Transcript 3 (OIT3) CLIA Kit
abx197375-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx572145-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human OIT3/ Oncoprotein-induced transcript 3 protein ELISA Kit
E1825Hu	Sunlong	1 Kit	EUR 571

Human OIT3(Oncoprotein-induced transcript 3 protein) ELISA Kit
EH1902	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q8WWZ8 Alias: OIT3(Oncoprotein Induced Transcript 3)/LZP/Liver-specific zona pellucida domain-containing protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Oncoprotein- induced transcript 3 protein, OIT3 ELISA KIT
ELI-05609h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human OIT3 (Oncoprotein Induced Transcript 3)
ELK2163	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Oncoprotein Induced Transcript 3 (OIT3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif Show more
Description: A sandwich ELISA kit for detection of Oncoprotein Induced Transcript 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human OIT3 (Oncoprotein Induced Transcript 3)
E-EL-H1017	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OIT3. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant

Rat Oncoprotein Induced Transcript 3 (OIT3) Protein
20-abx168546	Abbexa	EUR 732.00 EUR 286.00 EUR 2291.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cow Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx518270-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx518272-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit
abx518273-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Mouse OIT3 (Oncoprotein Induced Transcript 3)
E-EL-M0858	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse OIT3. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant

Mouse Oncoprotein- induced transcript 3 protein, Oit3 ELISA KIT
ELI-05607m	Lifescience Market	96 Tests	EUR 865

Bovine Oncoprotein- induced transcript 3 protein, OIT3 ELISA KIT
ELI-05610b	Lifescience Market	96 Tests	EUR 928

Guinea pig Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit
abx357801-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Rat OIT3 (Oncoprotein Induced Transcript 3)
E-EL-R0690	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat OIT3. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human OIT3 (Oncoprotein Induced Transcript 3)
E-CL-H0686	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's OIT3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human OIT3 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse)
4-PAB729Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3)

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat)
4-PAB729Ra01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3)

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), APC
4-PAB729Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAB729Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Biotin.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), Cy3
4-PAB729Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Cy3.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), FITC
4-PAB729Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with FITC.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), HRP
4-PAB729Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with HRP.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), PE
4-PAB729Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with PE.

Human Oncoprotein Induced Transcript 3 ELISA kit
E01O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Oncoprotein Induced Transcript 3 ELISA kit
E01O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Oncoprotein Induced Transcript 3 ELISA kit
E01O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), APC
4-PAB729Ra01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAB729Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Biotin.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAB729Ra01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Cy3.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), FITC
4-PAB729Ra01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with FITC.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), HRP
4-PAB729Ra01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with HRP.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), PE
4-PAB729Ra01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with PE.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAB729Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Val297~Arg506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC-Cy7.

Rat Oncoprotein Induced Transcript 3 ELISA kit
E02O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Oncoprotein Induced Transcript 3 ELISA kit
E02O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Oncoprotein Induced Transcript 3 ELISA kit
E02O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Oncoprotein Induced Transcript 3 ELISA kit
E03O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Oncoprotein Induced Transcript 3 ELISA kit
E03O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Oncoprotein Induced Transcript 3 ELISA kit
E03O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Oncoprotein Induced Transcript 3 ELISA kit
E04O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Oncoprotein Induced Transcript 3 ELISA kit
E04O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Oncoprotein Induced Transcript 3 ELISA kit
E04O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Oncoprotein Induced Transcript 3 ELISA kit
E08O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Oncoprotein Induced Transcript 3 ELISA kit
E08O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Oncoprotein Induced Transcript 3 ELISA kit
E08O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Oncoprotein Induced Transcript 3 ELISA kit
E09O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Oncoprotein Induced Transcript 3 ELISA kit
E09O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Oncoprotein Induced Transcript 3 ELISA kit
E09O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Oncoprotein Induced Transcript 3 ELISA kit
E07O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Oncoprotein Induced Transcript 3 ELISA kit
E07O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Oncoprotein Induced Transcript 3 ELISA kit
E07O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Oncoprotein Induced Transcript 3 ELISA kit
E06O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Oncoprotein Induced Transcript 3 ELISA kit
E06O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Oncoprotein Induced Transcript 3 ELISA kit
E06O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAB729Ra01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OIT3 (Arg251~Asp524) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC-Cy7.

Guinea pig Oncoprotein Induced Transcript 3 ELISA kit
E05O0014-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Oncoprotein Induced Transcript 3 ELISA kit
E05O0014-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Oncoprotein Induced Transcript 3 ELISA kit
E05O0014-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Oncoprotein-induced transcript 3 protein
EK3911	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Oncoprotein-induced transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids.

Oit3/ Rat Oit3 ELISA Kit
ELI-05608r	Lifescience Market	96 Tests	EUR 886

Human OIT3 ELISA Kit
EHO0021	Abclonal	96Tests	EUR 521

Human OIT3 ELISA Kit
ELA-E1729h	Lifescience Market	96 Tests	EUR 824

OIT3 ELISA KIT|Human
EF006016	Lifescience Market	96 Tests	EUR 689

OIT3 ELISA Kit (Human) (OKCD07626)
OKCD07626	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.109ng/mL

OIT3 ELISA Kit (Human) (OKEH01240)
OKEH01240	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL

Goat OIT3 ELISA Kit
EGTO0021	Abclonal	96Tests	EUR 521

Bovine OIT3 ELISA Kit
EBO0021	Abclonal	96Tests	EUR 521

Chicken OIT3 ELISA Kit
ECKO0021	Abclonal	96Tests	EUR 521

Canine OIT3 ELISA Kit
ECO0021	Abclonal	96Tests	EUR 521

Anserini OIT3 ELISA Kit
EAO0021	Abclonal	96Tests	EUR 521

Porcine OIT3 ELISA Kit
EPO0021	Abclonal	96Tests	EUR 521

Rat OIT3 ELISA Kit
ERO0021	Abclonal	96Tests	EUR 521

Rabbit OIT3 ELISA Kit
ERTO0021	Abclonal	96Tests	EUR 521

Sheep OIT3 ELISA Kit
ESO0021	Abclonal	96Tests	EUR 521

Monkey OIT3 ELISA Kit
EMKO0021	Abclonal	96Tests	EUR 521

Mouse OIT3 ELISA Kit
EMO0021	Abclonal	96Tests	EUR 521

RAET1E Human, Retinoic Acid Early Transcript 1E Human Recombinant Protein, IgG-His Tag
PROTQ8TD07-3	BosterBio	Regular: 10ug	EUR 317
Description: RAET1E Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 437 amino acids (31-225 a.a.) and having a molecular mass of 49.6kDa (Molecular size on SDS-PAGE will appear at approximately 57-70kDa).;RAET1E is expressed with a 239 amino acids IgG-His tag at C-Terminus and purified by proprietary chromatographic techniques.

Glucocorticoid-Induced Transcript 1 Protein (GLCCI1) Antibody
abx027065-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glucocorticoid-Induced Transcript 1 Protein (GLCCI1) Antibody
abx027065-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Guinea Pig OIT3 ELISA Kit
EGO0021	Abclonal	96Tests	EUR 521

OIT3 ELISA Kit (Mouse) (OKEI00499)
OKEI00499	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: May be involved in hepatocellular function and development.By similarity ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

OIT3 ELISA Kit (Rat) (OKEI00805)
OKEI00805	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: May be involved in hepatocellular function and development.By similarity ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37.5 pg/mL

HPV16 E7 Oncoprotein ELISA Kit
VPK-5045	Cell Biolabs	96 assays	EUR 740

HPV16 E7 Oncoprotein ELISA Kit
VPK-5045-5	Cell Biolabs	5 x 96 assays	EUR 2984

HPV18 E7 Oncoprotein ELISA Kit
VPK-5046	Cell Biolabs	96 assays	EUR 740

HPV18 E7 Oncoprotein ELISA Kit
VPK-5046-5	Cell Biolabs	5 x 96 assays	EUR 2984

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

OIT3 siRNA
20-abx903740	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OIT3 siRNA
20-abx926818	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OIT3 siRNA
20-abx926819	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OIT3 Antibody
42931-100ul	SAB	100ul	EUR 252

Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Damage Inducible Transcript 3 ELISA kit
E01D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE60509-48T	Abbkine	48T	EUR 332
TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE60509-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE60509-96T	Abbkine	96T	EUR 539
TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human OIT3 shRNA Plasmid
20-abx966105	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

OIT3 Recombinant Protein (Human)
RP041842	ABM	100 ug	Ask for price

OIT3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1480804	ABM	1.0 ug DNA	EUR 154

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
abx572989-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Trem- like transcript 3 protein, TREML3 ELISA KIT
ELI-28430h	Lifescience Market	96 Tests	EUR 824

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
20-abx151267	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
abx251801-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
DLR-BAT3-Hu-48T	DL Develop	48T	EUR 517
Should the Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human HLA-B Associated Transcript 3 (BAT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
DLR-BAT3-Hu-96T	DL Develop	96T	EUR 673
Should the Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human HLA-B Associated Transcript 3 (BAT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Hu-48T	DL Develop	48T	EUR 517
Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Hu-96T	DL Develop	96T	EUR 673
Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human HLA-B associated transcript 3 (BAT3) ELISA kit
CSB-EL002567HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human HLA-B associated transcript 3 (BAT3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human HLA-B associated transcript 3 (BAT3) ELISA kit
1-CSB-EL002567HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human HLA-B associated transcript 3 (BAT3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human DNA Damage Inducible Transcript 3 ELISA Kit (DDIT3)
RK01255	Abclonal	96 Tests	EUR 521

Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RD-BAT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RD-BAT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RDR-BAT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit
RDR-BAT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
SEJ282Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
4-SEJ282Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as DNA Damage Inducible Transcript 3 elisa. Alternative names of the recognized antigen: CEBPZ CHOP CHOP10 GADD153 C/EBP-homologous protein 10 CCAAT/enhancer-binding protein homologous protein Growth arrest and DNA damage-inducible G Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Protein
20-abx069428	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Amphoterin induced protein 3(AMIGO3) ELISA kit
E01A1423-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 3(AMIGO3) ELISA kit
E01A1423-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 3(AMIGO3) ELISA kit
E01A1423-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Retinoic acid induced protein 3 ELISA kit
E01R0359-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Retinoic acid induced protein 3 ELISA kit
E01R0359-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Retinoic acid induced protein 3 ELISA kit
E01R0359-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin- induced protein 3, AMIGO3 ELISA KIT
ELI-49226h	Lifescience Market	96 Tests	EUR 824

FSH (Human Follicle-stimulating hormone) ELISA test
3	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

OIT3 Conjugated Antibody
C42931	SAB	100ul	EUR 397

OIT3 cloning plasmid
CSB-CL848834HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 966 Sequence: atgcctccattcctgcttctcacctgcctcttcatcacaggcacctccgtgtcacccgtggccctagatccttgttctgcttacatcagcctgaatgagccctggaggaacactgaccaccagttggatgagtctcaaggtcctcctctatgtgacaaccatgtgaatggggagtg Show more
Description: A cloning plasmid for the OIT3 gene.

ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE100207-48T	Abbkine	48T	EUR 332
TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE100207-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE100207-96T	Abbkine	96T	EUR 539
TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE10101-48T	Abbkine	48T	EUR 354
Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE10101-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE10101-96T	Abbkine	96T	EUR 572
Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE70368-48T	Abbkine	48T	EUR 332
TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE70368-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1)
KTE70368-96T	Abbkine	96T	EUR 539
TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat DNA Damage Inducible Transcript 3 ELISA kit
E06D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA Damage Inducible Transcript 3 ELISA kit
E02D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA Damage Inducible Transcript 3 ELISA kit
E03D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit DNA Damage Inducible Transcript 3 ELISA kit
E04D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog DNA Damage Inducible Transcript 3 ELISA kit
E08D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey DNA Damage Inducible Transcript 3 ELISA kit
E09D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0529-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0529-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig DNA Damage Inducible Transcript 3 ELISA kit
E07D0529-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

OIT3 ORF Vector (Human) (pORF)
ORF013948	ABM	1.0 ug DNA	EUR 354

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
20-abx116180	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Antibody
20-abx104667	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Antibody
20-abx104668	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
20-abx006206	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
20-abx326733	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
20-abx338504	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody
20-abx329801	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Recombinant Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1)
4-RPH039Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O43294 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.8kDa Isoelectric Point: 6.7
Description: Recombinant Human Transforming Growth Factor Beta 1 Induced Transcript 1 expressed in: E.coli

Recombinant Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1)
4-RPH039Ra01	Cloud-Clone	EUR 510.37 EUR 239.00 EUR 1638.88 EUR 612.96 EUR 1125.92 EUR 404.00 EUR 3947.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99PD6 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.0kDa Isoelectric Point: 8
Description: Recombinant Rat Transforming Growth Factor Beta 1 Induced Transcript 1 expressed in: E.coli

Human DDIT3/ DNA damage-inducible transcript 3 protein ELISA Kit
E0666Hu	Sunlong	1 Kit	EUR 605

ELISA kit for Human DNA damage-inducible transcript 3 protein
EK4899	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA damage-inducible transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DDIT3(DNA damage-inducible transcript 3 protein) ELISA Kit
EH2438	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml Uniprot ID: P35638 Alias: DDIT3/CEBP zeta/CHOP/CHOP10/C,EBP-homologous protein/C,EBP-homologous protein 10/CCAAT,enhancer-binding protein homologous protein/CHOP-10/CHOP10 CEBPZ/CHOPC,EBP zeta/DDIT-3/DNA damage-induc Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

ELISA kit for Human DDIT3 (DNA Damage Inducible Transcript 3)
ELK4381	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to DNA Damage Inducible Transcript 3 (DDIT3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of DNA Damage Inducible Transcript 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human HLA-B associated transcript 3 (BAT3)
KTE62697-48T	Abbkine	48T	EUR 332
BAT3 contains an N-terminal ubiquitin-like domain, and both BAT2 and BAT3 are rich in proline and include short tracts of polyproline, polyglycine, and charged amino acids.The presence of additional genes was suggested by a large cluster of CpG islan Show more
Description: Quantitative sandwich ELISA for measuring Human HLA-B associated transcript 3 (BAT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human HLA-B associated transcript 3 (BAT3)
KTE62697-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
BAT3 contains an N-terminal ubiquitin-like domain, and both BAT2 and BAT3 are rich in proline and include short tracts of polyproline, polyglycine, and charged amino acids.The presence of additional genes was suggested by a large cluster of CpG islan Show more
Description: Quantitative sandwich ELISA for measuring Human HLA-B associated transcript 3 (BAT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human HLA-B associated transcript 3 (BAT3)
KTE62697-96T	Abbkine	96T	EUR 539
BAT3 contains an N-terminal ubiquitin-like domain, and both BAT2 and BAT3 are rich in proline and include short tracts of polyproline, polyglycine, and charged amino acids.The presence of additional genes was suggested by a large cluster of CpG islan Show more
Description: Quantitative sandwich ELISA for measuring Human HLA-B associated transcript 3 (BAT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Polyclonal Antibody (Human)
4-PAH039Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGFb1I1 (Phe252~Arg390+RCARTTSTHDAARCAPRVASL) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1)

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Interferon Induced Transmembrane Protein 3 (IFITM3) ELISA Kit
20-abx585213	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

ELISA kit for Human Interferon-induced transmembrane protein 3
EK2513	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced transmembrane protein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IFITM3/ Interferon-induced transmembrane protein 3 ELISA Kit
E1218Hu	Sunlong	1 Kit	EUR 605

Human IFITM3(Interferon-induced transmembrane protein 3) ELISA Kit
EH1111	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: Q01628 Alias: IFITM3/Fragilis/IP15/mil-1/1-8U/DSPA2b/interferon induced transmembrane protein 3/interferon-induced transmembrane protein 3/Interferon-inducible protein 1-8U
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Retinoic acid- induced protein 3, GPRC5A ELISA KIT
ELI-30398h	Lifescience Market	96 Tests	EUR 824

Human Interferon Induced Transmembrane Protein 3 (IFITM3) ELISA Kit
abx250358-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Oit3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3692304	ABM	1.0 ug DNA	EUR 154

Oit3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7394304	ABM	1.0 ug DNA	EUR 154

Oit3 3'UTR GFP Stable Cell Line
TU164538	ABM	1.0 ml	Ask for price

OIT3 3'UTR Luciferase Stable Cell Line
TU016235	ABM	1.0 ml	EUR 1394

Oit3 3'UTR Luciferase Stable Cell Line
TU114538	ABM	1.0 ml	Ask for price

OIT3 3'UTR GFP Stable Cell Line
TU066235	ABM	1.0 ml	EUR 1394

Oit3 3'UTR GFP Stable Cell Line
TU264389	ABM	1.0 ml	Ask for price

Oit3 3'UTR Luciferase Stable Cell Line
TU214389	ABM	1.0 ml	Ask for price