Human OIT3(Oncoprotein Induced Transcript 3) ELISA Kit
To Order Contact us: [email protected]
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
RD-OIT3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
RD-OIT3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Oncoprotein Induced Transcript 3 (OIT3) Antibody |
20-abx103361 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Oncoprotein Induced Transcript 3 (OIT3) Antibody |
20-abx130349 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Oncoprotein Induced Transcript 3 (OIT3) Antibody |
20-abx173889 |
Abbexa |
|
|
|
Recombinant Oncoprotein Induced Transcript 3 (OIT3) |
4-RPB729Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8WWZ8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.5kDa
- Isoelectric Point: 6.7
|
Description: Recombinant Human Oncoprotein Induced Transcript 3 expressed in: E.coli |
Recombinant Oncoprotein Induced Transcript 3 (OIT3) |
4-RPB729Ra01 |
Cloud-Clone |
-
EUR 528.29
-
EUR 244.00
-
EUR 1706.08
-
EUR 635.36
-
EUR 1170.72
-
EUR 416.00
-
EUR 4115.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6V0K7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Oncoprotein Induced Transcript 3 expressed in: E.coli |
human oncoprotein induced transcript 3,OIT3 ELISA Kit |
201-12-1685 |
SunredBio |
96 tests |
EUR 440 |
- This oncoprotein induced transcript 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx054228-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
20-abx152587 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx251220-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human oncoprotein induced transcript 3(OIT3)ELISA Kit |
GA-E1701HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human oncoprotein induced transcript 3(OIT3)ELISA Kit |
GA-E1701HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human oncoprotein induced transcript 3(OIT3)ELISA Kit |
QY-E04362 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
SEB729Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids. |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
SEB729Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids. |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
SEB729Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids. |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
SEB729Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oncoprotein Induced Transcript 3 (OIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in Tissue homogenates and other biological fluids. |
Human Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
4-SEB729Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Oncoprotein Induced Transcript 3 elisa. Alternative names of the recognized antigen: LZP
- Liver-specific zona pellucida domain-containing protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Oncoprotein Induced Transcript 3 (OIT3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Oncoprotein Induced Transcript 3 (OIT3) Protein |
20-abx068385 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Monkey Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx359276-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx361216-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx362383-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx352919-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx353817-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Chicken Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx357030-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Oncoprotein Induced Transcript 3 (OIT3) CLIA Kit |
abx197375-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Oncoprotein Induced Transcript 3 (OIT3) CLIA Kit |
20-abx493026 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human OIT3 (Oncoprotein Induced Transcript 3) |
E-EL-H1017 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OIT3. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant |
Human OIT3/ Oncoprotein-induced transcript 3 protein ELISA Kit |
E1825Hu |
Sunlong |
1 Kit |
EUR 571 |
Human OIT3(Oncoprotein-induced transcript 3 protein) ELISA Kit |
EH1902 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q8WWZ8
- Alias: OIT3(Oncoprotein Induced Transcript 3)/LZP/Liver-specific zona pellucida domain-containing protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Oncoprotein- induced transcript 3 protein, OIT3 ELISA KIT |
ELI-05609h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human OIT3 (Oncoprotein Induced Transcript 3) |
ELK2163 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Oncoprotein Induced Transcript 3 (OIT3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif
- Show more
|
Description: A sandwich ELISA kit for detection of Oncoprotein Induced Transcript 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit |
abx572145-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Oncoprotein Induced Transcript 3 (OIT3) Protein |
20-abx168546 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2291.00
-
EUR 871.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse OIT3 (Oncoprotein Induced Transcript 3) |
E-EL-M0858 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse OIT3. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat OIT3 (Oncoprotein Induced Transcript 3) |
E-EL-R0690 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's OIT3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat OIT3. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant |
Mouse Oncoprotein- induced transcript 3 protein, Oit3 ELISA KIT |
ELI-05607m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Oncoprotein- induced transcript 3 protein, OIT3 ELISA KIT |
ELI-05610b |
Lifescience Market |
96 Tests |
EUR 928 |
Guinea pig Oncoprotein Induced Transcript 3 (OIT3) ELISA Kit |
abx357801-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Cow Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit |
abx518270-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit |
abx518272-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Oncoprotein-induced transcript 3 protein (OIT3) ELISA Kit |
abx518273-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
CLIA kit for Human OIT3 (Oncoprotein Induced Transcript 3) |
E-CL-H0686 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's OIT3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human OIT3 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human OIT3 (Oncoprotein Induced Transcript 3) in samples from Serum, Plasma, Cell supernatant |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse) |
4-PAB729Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3) |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat) |
4-PAB729Ra01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3) |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), APC |
4-PAB729Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAB729Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Biotin. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAB729Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Cy3. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), FITC |
4-PAB729Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with FITC. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), HRP |
4-PAB729Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with HRP. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), PE |
4-PAB729Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with PE. |
Human Oncoprotein Induced Transcript 3 ELISA kit |
E01O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Oncoprotein Induced Transcript 3 ELISA kit |
E01O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Oncoprotein Induced Transcript 3 ELISA kit |
E01O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), APC |
4-PAB729Ra01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAB729Ra01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Biotin. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAB729Ra01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with Cy3. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAB729Ra01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with FITC. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAB729Ra01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with HRP. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), PE |
4-PAB729Ra01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with PE. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAB729Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Val297~Arg506)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC-Cy7. |
Rat Oncoprotein Induced Transcript 3 ELISA kit |
E02O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Oncoprotein Induced Transcript 3 ELISA kit |
E02O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Oncoprotein Induced Transcript 3 ELISA kit |
E02O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oncoprotein Induced Transcript 3 ELISA kit |
E04O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oncoprotein Induced Transcript 3 ELISA kit |
E04O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oncoprotein Induced Transcript 3 ELISA kit |
E04O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Oncoprotein Induced Transcript 3 ELISA kit |
E03O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Oncoprotein Induced Transcript 3 ELISA kit |
E03O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Oncoprotein Induced Transcript 3 ELISA kit |
E03O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Oncoprotein Induced Transcript 3 ELISA kit |
E08O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Oncoprotein Induced Transcript 3 ELISA kit |
E08O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Oncoprotein Induced Transcript 3 ELISA kit |
E08O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Oncoprotein Induced Transcript 3 ELISA kit |
E07O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Oncoprotein Induced Transcript 3 ELISA kit |
E07O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Oncoprotein Induced Transcript 3 ELISA kit |
E07O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Oncoprotein Induced Transcript 3 ELISA kit |
E06O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Oncoprotein Induced Transcript 3 ELISA kit |
E06O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Oncoprotein Induced Transcript 3 ELISA kit |
E06O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Oncoprotein Induced Transcript 3 ELISA kit |
E09O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Oncoprotein Induced Transcript 3 ELISA kit |
E09O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Oncoprotein Induced Transcript 3 ELISA kit |
E09O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Oncoprotein Induced Transcript 3 (OIT3) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAB729Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OIT3 (Arg251~Asp524)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Oncoprotein Induced Transcript 3 (OIT3). This antibody is labeled with APC-Cy7. |
Guinea pig Oncoprotein Induced Transcript 3 ELISA kit |
E05O0014-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Oncoprotein Induced Transcript 3 ELISA kit |
E05O0014-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Oncoprotein Induced Transcript 3 ELISA kit |
E05O0014-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Oncoprotein Induced Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Oncoprotein-induced transcript 3 protein |
EK3911 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Oncoprotein-induced transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human OIT3 ELISA Kit |
EHO0021 |
Abclonal |
96Tests |
EUR 521 |
OIT3 ELISA Kit (Human) (OKCD07626) |
OKCD07626 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.109ng/mL |
OIT3 ELISA Kit (Human) (OKEH01240) |
OKEH01240 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL |
Bovine OIT3 ELISA Kit |
EBO0021 |
Abclonal |
96Tests |
EUR 521 |
Anserini OIT3 ELISA Kit |
EAO0021 |
Abclonal |
96Tests |
EUR 521 |
Chicken OIT3 ELISA Kit |
ECKO0021 |
Abclonal |
96Tests |
EUR 521 |
Canine OIT3 ELISA Kit |
ECO0021 |
Abclonal |
96Tests |
EUR 521 |
Goat OIT3 ELISA Kit |
EGTO0021 |
Abclonal |
96Tests |
EUR 521 |
Porcine OIT3 ELISA Kit |
EPO0021 |
Abclonal |
96Tests |
EUR 521 |
Sheep OIT3 ELISA Kit |
ESO0021 |
Abclonal |
96Tests |
EUR 521 |
Rat OIT3 ELISA Kit |
ERO0021 |
Abclonal |
96Tests |
EUR 521 |
Rabbit OIT3 ELISA Kit |
ERTO0021 |
Abclonal |
96Tests |
EUR 521 |
Monkey OIT3 ELISA Kit |
EMKO0021 |
Abclonal |
96Tests |
EUR 521 |
Mouse OIT3 ELISA Kit |
EMO0021 |
Abclonal |
96Tests |
EUR 521 |
RAET1E Human, Retinoic Acid Early Transcript 1E Human Recombinant Protein, IgG-His Tag |
PROTQ8TD07-3 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: RAET1E Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 437 amino acids (31-225 a.a.) and having a molecular mass of 49.6kDa (Molecular size on SDS-PAGE will appear at approximately 57-70kDa).;RAET1E is expressed with a 239 amino acids IgG-His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Glucocorticoid-Induced Transcript 1 Protein (GLCCI1) Antibody |
abx027065-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glucocorticoid-Induced Transcript 1 Protein (GLCCI1) Antibody |
abx027065-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Guinea Pig OIT3 ELISA Kit |
EGO0021 |
Abclonal |
96Tests |
EUR 521 |
OIT3 ELISA Kit (Mouse) (OKEI00499) |
OKEI00499 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: May be involved in hepatocellular function and development.By similarity ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL |
OIT3 ELISA Kit (Rat) (OKEI00805) |
OKEI00805 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: May be involved in hepatocellular function and development.By similarity ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37.5 pg/mL |
HPV16 E7 Oncoprotein ELISA Kit |
VPK-5045 |
Cell Biolabs |
96 assays |
EUR 740 |
HPV16 E7 Oncoprotein ELISA Kit |
VPK-5045-5 |
Cell Biolabs |
5 x 96 assays |
EUR 2984 |
HPV18 E7 Oncoprotein ELISA Kit |
VPK-5046 |
Cell Biolabs |
96 assays |
EUR 740 |
HPV18 E7 Oncoprotein ELISA Kit |
VPK-5046-5 |
Cell Biolabs |
5 x 96 assays |
EUR 2984 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
OIT3 Antibody |
42931-100ul |
SAB |
100ul |
EUR 252 |
OIT3 siRNA |
20-abx903740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OIT3 siRNA |
20-abx926818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OIT3 siRNA |
20-abx926819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human DNA Damage Inducible Transcript 3 ELISA kit |
E01D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA Damage Inducible Transcript 3 ELISA kit |
E01D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA Damage Inducible Transcript 3 ELISA kit |
E01D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA Damage Inducible Transcript 3 ELISA kit |
E01D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA Damage Inducible Transcript 3 ELISA kit |
E01D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA Damage Inducible Transcript 3 ELISA kit |
E01D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE60509-48T |
Abbkine |
48T |
EUR 332 |
- TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE60509-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE60509-96T |
Abbkine |
96T |
EUR 539 |
- TGFB1I1 is a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate androgen receptor activity and may have a role to play in the t
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human OIT3 shRNA Plasmid |
20-abx966105 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OIT3 Recombinant Protein (Human) |
RP041842 |
ABM |
100 ug |
Ask for price |
OIT3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1480804 |
ABM |
1.0 ug DNA |
EUR 154 |
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit |
DLR-BAT3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human HLA-B Associated Transcript 3 (BAT3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit |
DLR-BAT3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human HLA-B Associated Transcript 3 (BAT3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
DLR-DDIT3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
DLR-DDIT3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
20-abx151267 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
abx251801-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Trem- like transcript 3 protein, TREML3 ELISA KIT |
ELI-28430h |
Lifescience Market |
96 Tests |
EUR 824 |
Human HLA-B associated transcript 3 (BAT3) ELISA kit |
CSB-EL002567HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human HLA-B associated transcript 3 (BAT3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human HLA-B associated transcript 3 (BAT3) ELISA kit |
1-CSB-EL002567HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human HLA-B associated transcript 3 (BAT3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
abx572989-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human DNA Damage Inducible Transcript 3 ELISA Kit (DDIT3) |
RK01255 |
Abclonal |
96 Tests |
EUR 521 |
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit |
RDR-BAT3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit |
RDR-BAT3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
RDR-DDIT3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
RDR-DDIT3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit |
RD-BAT3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human HLA-B Associated Transcript 3 (BAT3) ELISA Kit |
RD-BAT3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
RD-DDIT3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
RD-DDIT3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
SEJ282Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
SEJ282Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
SEJ282Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
SEJ282Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human DNA Damage Inducible Transcript 3 (DDIT3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in tissue homogenates, cell lysates and other biological fluids. |
Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit |
4-SEJ282Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as DNA Damage Inducible Transcript 3 elisa. Alternative names of the recognized antigen: CEBPZ
- CHOP
- CHOP10
- GADD153
- C/EBP-homologous protein 10
- CCAAT/enhancer-binding protein homologous protein
- Growth arrest and DNA damage-inducible G
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Protein |
20-abx069428 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Amphoterin induced protein 3(AMIGO3) ELISA kit |
E01A1423-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 3(AMIGO3) ELISA kit |
E01A1423-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 3(AMIGO3) ELISA kit |
E01A1423-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Retinoic acid induced protein 3 ELISA kit |
E01R0359-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Retinoic acid induced protein 3 ELISA kit |
E01R0359-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Retinoic acid induced protein 3 ELISA kit |
E01R0359-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin- induced protein 3, AMIGO3 ELISA KIT |
ELI-49226h |
Lifescience Market |
96 Tests |
EUR 824 |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
OIT3 Conjugated Antibody |
C42931 |
SAB |
100ul |
EUR 397 |
OIT3 cloning plasmid |
CSB-CL848834HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 966
- Sequence: atgcctccattcctgcttctcacctgcctcttcatcacaggcacctccgtgtcacccgtggccctagatccttgttctgcttacatcagcctgaatgagccctggaggaacactgaccaccagttggatgagtctcaaggtcctcctctatgtgacaaccatgtgaatggggagtg
- Show more
|
Description: A cloning plasmid for the OIT3 gene. |
ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE100207-48T |
Abbkine |
48T |
EUR 332 |
- TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE100207-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE100207-96T |
Abbkine |
96T |
EUR 539 |
- TGFB1I1 gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE10101-48T |
Abbkine |
48T |
EUR 354 |
- Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE10101-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE10101-96T |
Abbkine |
96T |
EUR 572 |
- Transforming growth factor beta-1-induced transcript 1 protein encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. TGFB1I1 is thought to regulate and
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE70368-48T |
Abbkine |
48T |
EUR 332 |
- TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE70368-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) |
KTE70368-96T |
Abbkine |
96T |
EUR 539 |
- TGFB1I1 encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat DNA Damage Inducible Transcript 3 ELISA kit |
E02D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA Damage Inducible Transcript 3 ELISA kit |
E02D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA Damage Inducible Transcript 3 ELISA kit |
E02D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA Damage Inducible Transcript 3 ELISA kit |
E02D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA Damage Inducible Transcript 3 ELISA kit |
E02D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA Damage Inducible Transcript 3 ELISA kit |
E02D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse DNA Damage Inducible Transcript 3 ELISA kit |
E03D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse DNA Damage Inducible Transcript 3 ELISA kit |
E03D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse DNA Damage Inducible Transcript 3 ELISA kit |
E03D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse DNA Damage Inducible Transcript 3 ELISA kit |
E03D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse DNA Damage Inducible Transcript 3 ELISA kit |
E03D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse DNA Damage Inducible Transcript 3 ELISA kit |
E03D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat DNA Damage Inducible Transcript 3 ELISA kit |
E06D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat DNA Damage Inducible Transcript 3 ELISA kit |
E06D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat DNA Damage Inducible Transcript 3 ELISA kit |
E06D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat DNA Damage Inducible Transcript 3 ELISA kit |
E06D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat DNA Damage Inducible Transcript 3 ELISA kit |
E06D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat DNA Damage Inducible Transcript 3 ELISA kit |
E06D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit DNA Damage Inducible Transcript 3 ELISA kit |
E04D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit DNA Damage Inducible Transcript 3 ELISA kit |
E04D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit DNA Damage Inducible Transcript 3 ELISA kit |
E04D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit DNA Damage Inducible Transcript 3 ELISA kit |
E04D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit DNA Damage Inducible Transcript 3 ELISA kit |
E04D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit DNA Damage Inducible Transcript 3 ELISA kit |
E04D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey DNA Damage Inducible Transcript 3 ELISA kit |
E09D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey DNA Damage Inducible Transcript 3 ELISA kit |
E09D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey DNA Damage Inducible Transcript 3 ELISA kit |
E09D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey DNA Damage Inducible Transcript 3 ELISA kit |
E09D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey DNA Damage Inducible Transcript 3 ELISA kit |
E09D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey DNA Damage Inducible Transcript 3 ELISA kit |
E09D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog DNA Damage Inducible Transcript 3 ELISA kit |
E08D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog DNA Damage Inducible Transcript 3 ELISA kit |
E08D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog DNA Damage Inducible Transcript 3 ELISA kit |
E08D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog DNA Damage Inducible Transcript 3 ELISA kit |
E08D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog DNA Damage Inducible Transcript 3 ELISA kit |
E08D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog DNA Damage Inducible Transcript 3 ELISA kit |
E08D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig DNA Damage Inducible Transcript 3 ELISA kit |
E07D0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig DNA Damage Inducible Transcript 3 ELISA kit |
E07D0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig DNA Damage Inducible Transcript 3 ELISA kit |
E07D0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig DNA Damage Inducible Transcript 3 ELISA kit |
E07D0529-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig DNA Damage Inducible Transcript 3 ELISA kit |
E07D0529-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig DNA Damage Inducible Transcript 3 ELISA kit |
E07D0529-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine DNA Damage Inducible Transcript 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody |
20-abx006206 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Antibody |
20-abx104667 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) Antibody |
20-abx104668 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody |
20-abx116180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody |
20-abx329801 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody |
20-abx326733 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFB1I1) Antibody |
20-abx338504 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
OIT3 ORF Vector (Human) (pORF) |
ORF013948 |
ABM |
1.0 ug DNA |
EUR 354 |
Recombinant Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) |
4-RPH039Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43294
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.8kDa
- Isoelectric Point: 6.7
|
Description: Recombinant Human Transforming Growth Factor Beta 1 Induced Transcript 1 expressed in: E.coli |
Recombinant Transforming Growth Factor Beta 1 Induced Transcript 1 (TGFb1I1) |
4-RPH039Ra01 |
Cloud-Clone |
-
EUR 510.37
-
EUR 239.00
-
EUR 1638.88
-
EUR 612.96
-
EUR 1125.92
-
EUR 404.00
-
EUR 3947.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99PD6
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.0kDa
- Isoelectric Point: 8
|
Description: Recombinant Rat Transforming Growth Factor Beta 1 Induced Transcript 1 expressed in: E.coli |
Human DDIT3/ DNA damage-inducible transcript 3 protein ELISA Kit |
E0666Hu |
Sunlong |
1 Kit |
EUR 605 |
ELISA kit for Human DNA damage-inducible transcript 3 protein |
EK4899 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA damage-inducible transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human DDIT3(DNA damage-inducible transcript 3 protein) ELISA Kit |
EH2438 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P35638
- Alias: DDIT3/CEBP zeta/CHOP/CHOP10/C,EBP-homologous protein/C,EBP-homologous protein 10/CCAAT,enhancer-binding protein homologous protein/CHOP-10/CHOP10 CEBPZ/CHOPC,EBP zeta/DDIT-3/DNA damage-induc
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
ELISA kit for Human DDIT3 (DNA Damage Inducible Transcript 3) |
ELK4381 |
ELK Biotech |