Human IL25(Interleukin 25) ELISA Kit

Human IL25(Interleukin 25) ELISA Kit

To Order Contact us: [email protected]

Human Interleukin 25 (IL25) ELISA Kit
RD-IL25-Hu-48Tests	Reddot Biotech	48 Tests	EUR 439

Human Interleukin 25 (IL25) ELISA Kit
RD-IL25-Hu-96Tests	Reddot Biotech	96 Tests	EUR 606

Mouse Interleukin 25 (IL25) ELISA Kit
DLR-IL25-Mu-48T	DL Develop	48T	EUR 454
Should the Mouse Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit
DLR-IL25-Mu-96T	DL Develop	96T	EUR 587
Should the Mouse Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
DLR-IL25-Ra-48T	DL Develop	48T	EUR 475
Should the Rat Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
DLR-IL25-Ra-96T	DL Develop	96T	EUR 616
Should the Rat Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit
RDR-IL25-Mu-48Tests	Reddot Biotech	48 Tests	EUR 470

Mouse Interleukin 25 (IL25) ELISA Kit
RDR-IL25-Mu-96Tests	Reddot Biotech	96 Tests	EUR 651

Rat Interleukin 25 (IL25) ELISA Kit
RDR-IL25-Ra-48Tests	Reddot Biotech	48 Tests	EUR 495

Rat Interleukin 25 (IL25) ELISA Kit
RDR-IL25-Ra-96Tests	Reddot Biotech	96 Tests	EUR 685

Mouse Interleukin 25 (IL25) ELISA Kit
RD-IL25-Mu-48Tests	Reddot Biotech	48 Tests	EUR 450

Mouse Interleukin 25 (IL25) ELISA Kit
RD-IL25-Mu-96Tests	Reddot Biotech	96 Tests	EUR 622

Rat Interleukin 25 (IL25) ELISA Kit
RD-IL25-Ra-48Tests	Reddot Biotech	48 Tests	EUR 473

Rat Interleukin 25 (IL25) ELISA Kit
RD-IL25-Ra-96Tests	Reddot Biotech	96 Tests	EUR 655

Human Interleukin 25, IL25 ELISA Kit
DEIA154	Creative Diagnostics	10 plates	EUR 2495
Description: Human IL-17E ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant IL-17E in a sandwich ELISA format within the range of 32-2,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay IL-17E in approximately 1,000 ELISA plate wells.

Human Interleukin 25 (IL25) ELISA Kit
20-abx152033	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 25 (IL25) ELISA Kit
abx251108-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Interleukin 25 (IL25) ELISA Kit
abx251203-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human IL25/ Interleukin-25 ELISA Kit
E1283Hu	Sunlong	1 Kit	EUR 571

Human Interleukin- 25, IL25 ELISA KIT
ELI-05518h	Lifescience Market	96 Tests	EUR 824

Human Interleukin 25 (IL25) ELISA Kit
abx574506-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Interleukin 25 (IL25) ELISA Kit
SEB694Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit
SEB694Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit
SEB694Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit
SEB694Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit
4-SEB694Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 25 (IL25) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Interleukin 25, Il25 ELISA Kit
DEIA187	Creative Diagnostics	96T	EUR 740
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Mouse Il25 in serum, plasma and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
20-abx155730	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25) ELISA Kit
20-abx154249	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25) ELISA Kit
abx254218-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Interleukin 25 (IL25) ELISA Kit
abx255763-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Interleukin 25 (IL25) ELISA Kit
SEB694Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit
SEB694Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit
SEB694Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit
SEB694Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit
4-SEB694Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Interleukin 25 (IL25) ELISA Kit
SEB694Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4875.49
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
SEB694Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 489.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
SEB694Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 655.94
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
SEB694Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2651.73
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit
4-SEB694Ra	Cloud-Clone	EUR 4926.00 EUR 2602.00 EUR 656.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Interleukin 25 ELISA Kit (IL25)
RK03761	Abclonal	96 Tests	EUR 521

Active Interleukin 25 (IL25)
4-APB694Hu01	Cloud-Clone	EUR 637.60 EUR 274.00 EUR 2116.00 EUR 772.00 EUR 1444.00 EUR 490.00 EUR 5140.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H293 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.5kDa Isoelectric Point: 8.6
Description: Recombinant Human Interleukin 25 expressed in: E.coli

Interleukin 25 (IL25) Antibody
20-abx005765	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Interleukin 25 (IL25) Antibody
20-abx177156	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Interleukin 25 (IL25) Antibody
20-abx101199	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 25 (IL25) Antibody
20-abx101200	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 25 (IL25) Antibody
abx037053-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Interleukin 25 (IL25) Antibody
20-abx130193	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 25 (IL25) Antibody
20-abx173144	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Interleukin 25 (IL25) Antibody
20-abx173145	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Interleukin 25 (IL25) Antibody
20-abx320531	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Interleukin 25 (IL25)
4-RPB694Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H293 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Interleukin 25 expressed in: E.coli

Recombinant Interleukin 25 (IL25)
4-RPB694Mu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8VHH8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.4kDa Isoelectric Point: 6.5
Description: Recombinant Mouse Interleukin 25 expressed in: E.coli

Recombinant Interleukin 25 (IL25)
4-RPB694Ra01	Cloud-Clone	EUR 528.29 EUR 244.00 EUR 1706.08 EUR 635.36 EUR 1170.72 EUR 416.00 EUR 4115.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZLB1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: Inquire
Description: Recombinant Rat Interleukin 25 expressed in: E.coli

ELISA kit for Human IL25 (Interleukin 25)
ELK2151	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 25 (IL25). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin Show more
Description: A sandwich ELISA kit for detection of Interleukin 25 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Interleukin 25 (IL25) CLIA Kit
20-abx190242	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 25 (IL25)CLIA Kit
SCB694Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25)CLIA Kit
SCB694Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25)CLIA Kit
SCB694Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25)CLIA Kit
SCB694Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25) CLIA Kit
4-SCB694Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 Clia kit. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25)Serum, plasma and other biological fluids

Human Interleukin 25 (IL25) Protein
20-abx067512	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ELISA kit for Mouse IL25 (Interleukin 25)
ELK3216	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 25 (IL25). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin Show more
Description: A sandwich ELISA kit for detection of Interleukin 25 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse interleukin 25(IL25/C19orf10) ELISA kit
CSB-EL003433MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse interleukin 25 (IL25/C19orf10) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse interleukin 25(IL25/C19orf10) ELISA kit
1-CSB-EL003433MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse interleukin 25(IL25/C19orf10) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Rat IL25 (Interleukin 25)
ELK6589	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 25 (IL25). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin Show more
Description: A sandwich ELISA kit for detection of Interleukin 25 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Interleukin 25 (IL25) CLIA Kit
20-abx190527	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Interleukin 25 (IL25) CLIA Kit
20-abx190697	Abbexa	EUR 8443.00 EUR 4497.00 EUR 1036.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25)CLIA Kit
SCB694Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5804.88
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25)CLIA Kit
SCB694Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 565.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25)CLIA Kit
SCB694Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 765.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25)CLIA Kit
SCB694Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3143.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25) CLIA Kit
4-SCB694Mu	Cloud-Clone	EUR 5855.00 EUR 3144.00 EUR 766.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 Clia kit. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25)Serum, plasma and other biological fluids

Rat Interleukin 25 (IL25)CLIA Kit
SCB694Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 6119.04
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25)CLIA Kit
SCB694Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 591.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25)CLIA Kit
SCB694Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 802.24
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25)CLIA Kit
SCB694Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3310.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) CLIA Kit
4-SCB694Ra	Cloud-Clone	EUR 6170.00 EUR 3311.00 EUR 803.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 Clia kit. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25)Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) Protein
20-abx167753	Abbexa	EUR 732.00 EUR 286.00 EUR 2291.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25) Protein
20-abx067513	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Interleukin 25 (IL25) Protein (Active)
20-abx651392	Abbexa	EUR 885.00 EUR 328.00 EUR 2834.00 EUR 1052.00 EUR 606.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 25 (IL25) Polyclonal Antibody (Human)
4-PAB694Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25)

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit
MEB694Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5523.45
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit
MEB694Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 542.52
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit
MEB694Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 732.17
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit
MEB694Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2994.77
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit
4-MEB694Mu	Cloud-Clone	EUR 5574.00 EUR 2945.00 EUR 733.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E IL17-E Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 25 (IL25) in samples from n/a with no significant corss-reactivity with analogues from other species.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse)
4-PAB694Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25)

Interleukin 25 (IL25) Polyclonal Antibody (Rat)
4-PAB694Ra01	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25)

Interleukin 25 (IL25) Polyclonal Antibody (Human), APC
4-PAB694Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with APC.

Interleukin 25 (IL25) Polyclonal Antibody (Human), Biotinylated
4-PAB694Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with Biotin.

Interleukin 25 (IL25) Polyclonal Antibody (Human), Cy3
4-PAB694Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with Cy3.

Interleukin 25 (IL25) Polyclonal Antibody (Human), FITC
4-PAB694Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with FITC.

Interleukin 25 (IL25) Polyclonal Antibody (Human), HRP
4-PAB694Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with HRP.

Interleukin 25 (IL25) Polyclonal Antibody (Human), PE
4-PAB694Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with PE.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)
CG64-10ug	Novoprotein	10ug	EUR 95
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)
CG64-1mg	Novoprotein	1mg	EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)
CG64-500ug	Novoprotein	500ug	EUR 1186
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)
CG64-50ug	Novoprotein	50ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Interleukin 25 (IL25) Polyclonal Antibody (Human), APC-Cy7
4-PAB694Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Met28~Gly177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with APC-Cy7.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), APC
4-PAB694Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with APC.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), Biotinylated
4-PAB694Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with Biotin.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), Cy3
4-PAB694Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with Cy3.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), FITC
4-PAB694Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with FITC.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), HRP
4-PAB694Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with HRP.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), PE
4-PAB694Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with PE.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), APC
4-PAB694Ra01-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with APC.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), Biotinylated
4-PAB694Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with Biotin.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), Cy3
4-PAB694Ra01-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with Cy3.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), FITC
4-PAB694Ra01-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with FITC.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), HRP
4-PAB694Ra01-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with HRP.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), PE
4-PAB694Ra01-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with PE.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB694Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Cys32~Cys148) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with APC-Cy7.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), APC-Cy7
4-PAB694Ra01-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL25 (Pro33~Ala169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with APC-Cy7.

Human Interleukin 25,IL-25 ELISA Kit
201-12-0055	SunredBio	96 tests	EUR 440
This Interleukin 25 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 25, IL-25 ELISA kit
CSB-E11715h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 25, IL-25 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 25, IL-25 ELISA kit
1-CSB-E11715h	Cusabio	EUR 603.00 EUR 4247.00 EUR 2260.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 25, IL-25 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 25(IL-25)ELISA Kit
GA-E0094HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 25(IL-25)ELISA Kit
GA-E0094HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 25(IL-25)ELISA Kit
QY-E04286	Qayee Biotechnology	96T	EUR 361

Human Interleukin 25 ELISA kit
E01I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 25 ELISA kit
E01I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 25 ELISA kit
E01I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human IL-25 (Interleukin 25)
E-EL-H1648	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-25. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

Mouse IL-25(Interleukin 25) ELISA Kit
EM1162	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: Q9CPT4 Alias: IL-25/IL-17E/Interleukin-17E/interleukin-25
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Rat IL-25(Interleukin 25) ELISA Kit
ER1097	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Alias: IL-25/IL-17E/Interleukin-17E/interleukin-25
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

ELISA kit for Human Interleukin-25
EK3881	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-25 in samples from serum, plasma, tissue homogenates and other biological fluids.

IL-25 ELISA Kit| Rat Interleukin 25 ELISA Kit
EF017844	Lifescience Market	96 Tests	EUR 689

IL-25 ELISA Kit| Mouse Interleukin 25 ELISA Kit
EF013718	Lifescience Market	96 Tests	EUR 689

Human IL-17E/IL-25(Interleukin 25) ELISA Kit
EH0180	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q9H293 Alias: IL-25/IL-17E
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human IL25 ELISA kit
55R-2185	Fitzgerald	96 tests	EUR 766
Description: ELISA Kit for detection of IL25 in the research laboratory

Human IL25 ELISA Kit
ELA-E1694h	Lifescience Market	96 Tests	EUR 824

Rat Interleukin 25 ELISA kit
E02I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 25 ELISA kit
E02I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 25 ELISA kit
E02I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 25 ELISA kit
E04I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 25 ELISA kit
E04I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 25 ELISA kit
E04I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 25 ELISA kit
E03I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 25 ELISA kit
E03I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 25 ELISA kit
E03I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 25 ELISA kit
E06I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 25 ELISA kit
E06I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 25 ELISA kit
E06I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 25 ELISA kit
E09I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 25 ELISA kit
E09I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 25 ELISA kit
E09I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 25 ELISA kit
E08I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 25 ELISA kit
E08I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 25 ELISA kit
E08I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 25 ELISA kit
E07I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 25 ELISA kit
E07I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 25 ELISA kit
E07I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse IL-25 (Interleukin 25)
E-EL-M0187	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-25. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat IL-25 (Interleukin 25)
E-EL-R2394	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IL-25. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

Human Interleukin-25 (IL-25) Antibody
32566-05111	AssayPro	150 ug	EUR 261

Guinea pig Interleukin 25 ELISA kit
E05I0205-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 25 ELISA kit
E05I0205-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 25 ELISA kit
E05I0205-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL25 ELISA Kit (Human) (OKAN04931)
OKAN04931	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL

IL25 ELISA Kit (Human) (OKBB00815)
OKBB00815	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: Interleukin-25 (IL-25), also known as interleukin-17E (IL-17E), is a protein that in humans is encoded by the IL25 gene. It is a cytokine that belongs to the IL-17 cytokine family and mapped to 14q11.2. IL-25 is secreted by type 2 helper T cells (Th2) and mast cells. It has been found that IL-25 can induce Th2-type cytokine expression and production by non-T, non-B accessory cells that express high levels of major histocompatibility complex class II and low levels of Cd11c. This cytokine also can induce NF-κB activation, and stimulate the production of IL8. What’s more, IL-25 is an important molecule controlling immunity of the gut and has been implicated in chronic inflammation associated with the gastrointestinal tract.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

IL25 ELISA Kit (Human) (OKCD07601)
OKCD07601	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Recombinant Human Interleukin-17E;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.9pg/mL

Mouse Interleukin 25 (IL-25) CLIA Kit
abx195891-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Interleukin 25 (IL-25) Antibody
abx430547-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Interleukin 25 (IL-25) Antibody
abx430548-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

CLIA kit for Mouse IL-25 (Interleukin 25)
E-CL-M0138	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's IL-25 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-25 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

Human Interleukin-25 (IL-25) Antibody (Biotin Conjugate)
32566-05121	AssayPro	150 ug	EUR 369

Recombinant Human Interleukin-25/IL-25 (C-6His)
C792-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Recombinant Human Interleukin-25/IL-25 (C-6His)
C792-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Recombinant Human Interleukin-25/IL-25 (C-6His)
C792-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Recombinant Human Interleukin-25/IL-25 (C-6His)
C792-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Express Plasmid Midiprep Kit (25 min)
K1323-25	Biovision		EUR 468

Express Plasmid Maxiprep Kit (25 min)
K1324-25	Biovision		EUR 610

Il25 ELISA Kit (Rat) (OKCD01599)
OKCD01599	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.8 pg/mL

IL25 ELISA Kit (Mouse) (OKCD07602)
OKCD07602	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Recombinant Mouse Interleukin-17E;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL

Amyloid Beta-peptide (25-35) (human)
A1039-25	ApexBio	25 mg	EUR 505
Description: Met-Leu-Gly-Ile-Ile-Ala-Gly-Lys-Asn-Ser-GlyAmyloid- ? (A?) peptide is commonly found in human Alzheimer?s disease (AD) brain and is the main component of Alzheimer amyloid plaques. The predominant forms of A? in the human brain are A? (1-40) and A? (1-42).

MTBK_20640-25
AR02-P0011-25	Abfrontier	25ug	EUR 473

Human Interleukin-25 (IL-25) AssayLite Antibody (FITC Conjugate)
32566-05141	AssayPro	150 ug	EUR 428

Human Interleukin-25 (IL-25) AssayLite Antibody (RPE Conjugate)
32566-05151	AssayPro	150 ug	EUR 428

Human Interleukin-25 (IL-25) AssayLite Antibody (APC Conjugate)
32566-05161	AssayPro	150 ug	EUR 428

Human Interleukin-25 (IL-25) AssayLite Antibody (PerCP Conjugate)
32566-05171	AssayPro	150 ug	EUR 471

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

IL25 Chemi-Luminescent ELISA Kit (Human) (OKCD03660)
OKCD03660	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Induces activation of NF-kappa-B and stimulates production of the proinflammatory chemokine IL-8. Proinflammatory cytokine favoring Th2-type immune responses. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

IL25 ELISA Kit (Human) : 96 Wells (OKEH02794)
OKEH02794	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.10 pg/mL

Agouti-related Protein (AGRP) (25-82), human
A1134-25	ApexBio	25 mg	EUR 1511
Description: Agouti-related protein also called Agouti-related peptide (AgRP) is a neuropeptide produced in the brain by the AgRP/NPY neuron. It is only synthesised in NPY containing cell bodies located in the ventromedial part of the arcuate nucleus in the hypothalamus(1).

Rv0351 (GrpE)-25
AR02-P0003-25	Abfrontier	25ug	EUR 126

Rv1009 (RpfB)-25
AR02-P0006-25	Abfrontier	25ug	EUR 473

Rv2450c (RpfE)-25
AR02-P0007-25	Abfrontier	25ug	EUR 473

Rv3875 (esxA)-25
AR02-P0008-25	Abfrontier	25ug	EUR 473

Rv2031c(HspX)-25
AR02-P0009-25	Abfrontier	25ug	EUR 473

Rv3131 (NfnB)-25
AR02-P0010-25	Abfrontier	25ug	EUR 473

IL25 Antibody
39503-100ul	SAB	100ul	EUR 390

IL25 Antibody
1-CSB-PA875653ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IL25. Recognizes IL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IL25 Antibody
DF2528	Affbiotech	200ul	EUR 304
Description: IL25 antibody detects endogenous levels of total IL25.

IL25 siRNA
20-abx920492	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IL25 Antibody
ABD2528	Lifescience Market	100 ug	EUR 438

pET32a-IL25
PVT17801	Lifescience Market	2 ug	EUR 258

26795 25 CLOSURE NTRL 25MM
26795-25	CORNING	50/pk	EUR 96
Description: Disposable Screw Cap Culture Tubes; Poly Closures

Human MMP-25(Matrix Metalloproteinase 25) ELISA Kit
EH3372	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9H239 Alias: MMP-25/Leukolysin/MT6-MMP/leukolysin/matrix metallopeptidase 25/matrix metallopeptidase-like 1/matrix metalloproteinase 20/matrix metalloproteinase 25/matrix metalloproteinase-25/matrix metall Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Matrix Metalloproteinase 25(MMP-25)ELISA Kit
QY-E02987	Qayee Biotechnology	96T	EUR 361

Human Hepcidine-25 bioactive(Hepc-25) ELISA Kit
QY-E05472	Qayee Biotechnology	96T	EUR 361

Human IL25 shRNA Plasmid
20-abx962104	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human 25-hydroxycholesterol ELISA kit
E01H1400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human 25-hydroxycholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 25-hydroxycholesterol ELISA kit
E01H1400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human 25-hydroxycholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 25-hydroxycholesterol ELISA kit
E01H1400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human 25-hydroxycholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 25 HVD3 ELISA Kit
EHA0674	Abclonal	96Tests	EUR 521

Human SNAP-25 ELISA Kit
EHS0043	Abclonal	96Tests	EUR 521

MMP-25 ELISA KIT|Human
EF006985	Lifescience Market	96 Tests	EUR 689

?-Interleukin I (163-171), human
A1026-25	ApexBio	25 mg	EUR 212
Description: ?-Interleukin I (163-171), human(C39H64N12O19), a peptide with the sequence Val-Gln-Gly-Glu-Glu-Ser-Asn-Asp-Lys, MW= 1005. Interleukins are a group of cytokines (secreted proteins/signaling molecules) that were first seen to be expressed by white blood cells (leukocytes).

Rv2769c (PE27 protein)-25
AR02-P0001-25	Abfrontier	25ug	EUR 203

2.5x14 cellogel 250µ (25)
EHCA1200-ST06-25	Consort	ea	EUR 38

2.5x14 cellogel 200µ (25)
EHCA1200-ST07-25	Consort	ea	EUR 38

2.5x17 cellogel 250µ (25)
EHCA1200-ST11-25	Consort	ea	EUR 41

2.5x17 cellogel 200µ (25)
EHCA1200-ST12-25	Consort	ea	EUR 41

5.7x13 cellogel 250µ (25)
EHCA1200-ST29U-25	Consort	ea	EUR 60

5.7x14 cellogel 250µ (25)
EHCA1200-ST31-25	Consort	ea	EUR 53

5.7x14 cellogel 200µ (25)
EHCA1200-ST32-25	Consort	ea	EUR 53

5.7x14 cellogel 500µ (25)
EHCA1200-ST34-25	Consort	ea	EUR 60

Hepc 25 ELISA Kit| Rat Hepcidin 25 ELISA Kit
EF018154	Lifescience Market	96 Tests	EUR 689

Hepc 25 ELISA Kit| Mouse Hepcidin 25 ELISA Kit
EF014042	Lifescience Market	96 Tests	EUR 689

BasicExoRNA? Basic RNA extraction kit (Pre-isolated exosomes, 25 reactions)
K1222-25	Biovision		EUR 729

Human 25-Dihydroxy vitamin D3(25(OH)D3/25 HVD3)ELISA Kit
GA-E1554HM-48T	GenAsia Biotech	48T	EUR 289

Human 25-Dihydroxy vitamin D3(25(OH)D3/25 HVD3)ELISA Kit
GA-E1554HM-96T	GenAsia Biotech	96T	EUR 466

Human 25-Dihydroxy vitamin D3(25(OH)D3/25 HVD3)ELISA Kit
QY-E05233	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human MMP-25 (Matrix Metalloproteinase 25)
E-EL-H0131	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MMP-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MMP-25. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MMP-25 (Matrix Metalloproteinase 25) in samples from Serum, Plasma, Cell supernatant

Human 25- Dihydroxy vitamin D3, 25- HVD3 ELISA Kit
CELI-66061h	Lifescience Market	96 Tests	EUR 824

IL25 Chemi-Luminescent ELISA Kit (Rat) (OKCD03659)
OKCD03659	Aviva Systems Biology	96 Wells	EUR 1066
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.37 pg/mL

IL25 Chemi-Luminescent ELISA Kit (Mouse) (OKCD03661)
OKCD03661	Aviva Systems Biology	96 Wells	EUR 1027
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Mouse Hepc 25(Hepcidin 25) ELISA Kit
EM1601	FN Test	96T	EUR 524.1
Detection range: 1.563-100 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938 ng/ml

Rat Hepc 25(Hepcidin 25) ELISA Kit
ER1504	FN Test	96T	EUR 476.25
Detection range: 1.563-100 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.5 ng/ml

DiagNano Fluorophore Labeled Gold Nanoparticles, 25 nm
GFL-25	Creative Diagnostics	1 mL	EUR 1053

DiaEasy? Dialyzer (3 ml) MWCO 25 kDa
K1015-25	Biovision		EUR 490

DiaEasy? Dialyzer (250 µl) MWCO 25 kDa
K1022-25	Biovision		EUR 349

IL25 Polyclonal Antibody
31486-100ul	SAB	100ul	EUR 252

IL25 Polyclonal Antibody
31486-50ul	SAB	50ul	EUR 187

IL25 Blocking Peptide
DF2528-BP	Affbiotech	1mg	EUR 195

IL25 cloning plasmid
CSB-CL875653HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 534 Sequence: atgagggagcgacccagattaggtgaggacagttctctcattagccttttcctacaggtggttgcattcttggcaatggtcatgggaacccacacctacagccactggcccagctgctgccccagcaaagggcaggacacctctgaggagctgctgaggtggagcactgtgcctgt Show more
Description: A cloning plasmid for the IL25 gene.

IL25 Rabbit pAb
A8252-100ul	Abclonal	100 ul	EUR 308

IL25 Rabbit pAb
A8252-200ul	Abclonal	200 ul	EUR 459

IL25 Rabbit pAb
A8252-20ul	Abclonal	20 ul	EUR 183

IL25 Rabbit pAb
A8252-50ul	Abclonal	50 ul	EUR 223

pCR4-TOPO-IL25
PVT17610	Lifescience Market	2 ug	EUR 231

Anti-IL25 antibody
STJ110551	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants.

ELISA kit for Human Synaptosome Associated Protein 25 (SNAP-25)  Kit
KTE62996-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Synaptosome Associated Protein 25 (SNAP-25)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptosome Associated Protein 25 (SNAP-25)  Kit
KTE62996-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Synaptosome Associated Protein 25 (SNAP-25)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.