Human IL25(Interleukin 25) ELISA Kit

Human IL25(Interleukin 25) ELISA Kit

To Order Contact us: [email protected]

Human Interleukin 25 (IL25) ELISA Kit

RD-IL25-Hu-48Tests 48 Tests
EUR 439

Human Interleukin 25 (IL25) ELISA Kit

RD-IL25-Hu-96Tests 96 Tests
EUR 606

Mouse Interleukin 25 (IL25) ELISA Kit

DLR-IL25-Mu-48T 48T
EUR 454
  • Should the Mouse Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit

DLR-IL25-Mu-96T 96T
EUR 587
  • Should the Mouse Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

DLR-IL25-Ra-48T 48T
EUR 475
  • Should the Rat Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

DLR-IL25-Ra-96T 96T
EUR 616
  • Should the Rat Interleukin 25 (IL25) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit

RDR-IL25-Mu-48Tests 48 Tests
EUR 470

Mouse Interleukin 25 (IL25) ELISA Kit

RDR-IL25-Mu-96Tests 96 Tests
EUR 651

Rat Interleukin 25 (IL25) ELISA Kit

RDR-IL25-Ra-48Tests 48 Tests
EUR 495

Rat Interleukin 25 (IL25) ELISA Kit

RDR-IL25-Ra-96Tests 96 Tests
EUR 685

Mouse Interleukin 25 (IL25) ELISA Kit

RD-IL25-Mu-48Tests 48 Tests
EUR 450

Mouse Interleukin 25 (IL25) ELISA Kit

RD-IL25-Mu-96Tests 96 Tests
EUR 622

Rat Interleukin 25 (IL25) ELISA Kit

RD-IL25-Ra-48Tests 48 Tests
EUR 473

Rat Interleukin 25 (IL25) ELISA Kit

RD-IL25-Ra-96Tests 96 Tests
EUR 655

Human Interleukin 25, IL25 ELISA Kit

DEIA154 10 plates
EUR 2495
Description: Human IL-17E ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant IL-17E in a sandwich ELISA format within the range of 32-2,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay IL-17E in approximately 1,000 ELISA plate wells.

Human Interleukin 25 (IL25) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 25 (IL25) ELISA Kit

abx251108-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Interleukin 25 (IL25) ELISA Kit

abx251203-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human IL25/ Interleukin-25 ELISA Kit

E1283Hu 1 Kit
EUR 571

Human Interleukin- 25, IL25 ELISA KIT

ELI-05518h 96 Tests
EUR 824

Human Interleukin 25 (IL25) ELISA Kit

abx574506-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Interleukin 25 (IL25) ELISA Kit

SEB694Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit

SEB694Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit

SEB694Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit

SEB694Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 25 (IL25) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 25 (IL25) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Interleukin 25, Il25 ELISA Kit

DEIA187 96T
EUR 740
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Mouse Il25 in serum, plasma and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25) ELISA Kit

abx254218-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Interleukin 25 (IL25) ELISA Kit

abx255763-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Interleukin 25 (IL25) ELISA Kit

SEB694Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit

SEB694Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit

SEB694Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit

SEB694Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Interleukin 25 (IL25) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Interleukin 25 (IL25) ELISA Kit

SEB694Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

SEB694Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

SEB694Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

SEB694Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) ELISA Kit

  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Interleukin 25 (IL25) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Interleukin 25 ELISA Kit (IL25)

RK03761 96 Tests
EUR 521

Active Interleukin 25 (IL25)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H293
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.5kDa
  • Isoelectric Point: 8.6
Description: Recombinant Human Interleukin 25 expressed in: E.coli

Interleukin 25 (IL25) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 25 (IL25) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 25 (IL25) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 25 (IL25) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 25 (IL25) Antibody

abx037053-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Interleukin 25 (IL25) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 25 (IL25) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 25 (IL25) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 25 (IL25) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Interleukin 25 (IL25)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H293
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Interleukin 25 expressed in: E.coli

Recombinant Interleukin 25 (IL25)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VHH8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.4kDa
  • Isoelectric Point: 6.5
Description: Recombinant Mouse Interleukin 25 expressed in: E.coli

Recombinant Interleukin 25 (IL25)

  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZLB1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Interleukin 25 expressed in: E.coli

ELISA kit for Human IL25 (Interleukin 25)

ELK2151 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 25 (IL25). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 25 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Interleukin 25 (IL25) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 25 (IL25)CLIA Kit

SCB694Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25)CLIA Kit

SCB694Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25)CLIA Kit

SCB694Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25)CLIA Kit

SCB694Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Human Interleukin 25 (IL25) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 Clia kit. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 25 (IL25)Serum, plasma and other biological fluids

Human Interleukin 25 (IL25) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Mouse IL25 (Interleukin 25)

ELK3216 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 25 (IL25). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 25 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse interleukin 25(IL25/C19orf10) ELISA kit

CSB-EL003433MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse interleukin 25 (IL25/C19orf10) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse interleukin 25(IL25/C19orf10) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse interleukin 25(IL25/C19orf10) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Rat IL25 (Interleukin 25)

ELK6589 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 25 (IL25). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 25 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Interleukin 25 (IL25) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Interleukin 25 (IL25) CLIA Kit

  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25)CLIA Kit

SCB694Mu-10x96wellstestplate 10x96-wells test plate
EUR 5804.88
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25)CLIA Kit

SCB694Mu-1x48wellstestplate 1x48-wells test plate
EUR 565.7
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25)CLIA Kit

SCB694Mu-1x96wellstestplate 1x96-wells test plate
EUR 765.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25)CLIA Kit

SCB694Mu-5x96wellstestplate 5x96-wells test plate
EUR 3143.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25) in serum, plasma and other biological fluids.

Mouse Interleukin 25 (IL25) CLIA Kit

  • EUR 5855.00
  • EUR 3144.00
  • EUR 766.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 Clia kit. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Interleukin 25 (IL25)Serum, plasma and other biological fluids

Rat Interleukin 25 (IL25)CLIA Kit

SCB694Ra-10x96wellstestplate 10x96-wells test plate
EUR 6119.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25)CLIA Kit

SCB694Ra-1x48wellstestplate 1x48-wells test plate
EUR 591.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25)CLIA Kit

SCB694Ra-1x96wellstestplate 1x96-wells test plate
EUR 802.24
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25)CLIA Kit

SCB694Ra-5x96wellstestplate 5x96-wells test plate
EUR 3310.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) CLIA Kit

  • EUR 6170.00
  • EUR 3311.00
  • EUR 803.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 Clia kit. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Rat Interleukin 25 (IL25)Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Interleukin 25 (IL25) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Interleukin 25 (IL25) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Interleukin 25 (IL25) Protein (Active)

  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 25 (IL25) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25)

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit

MEB694Mu-10x96wellstestplate 10x96-wells test plate
EUR 5523.45
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit

MEB694Mu-1x48wellstestplate 1x48-wells test plate
EUR 542.52
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit

MEB694Mu-1x96wellstestplate 1x96-wells test plate
EUR 732.17
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit

MEB694Mu-5x96wellstestplate 5x96-wells test plate
EUR 2994.77
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 25 (IL25) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 25 (IL25).

Mini Samples Mouse Interleukin 25 (IL25) ELISA Kit

  • EUR 5574.00
  • EUR 2945.00
  • EUR 733.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 25 elisa. Alternative names of the recognized antigen: IL17E
  • IL17-E
  • Interleukin-17E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 25 (IL25) in samples from n/a with no significant corss-reactivity with analogues from other species.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25)

Interleukin 25 (IL25) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25)

Interleukin 25 (IL25) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with APC.

Interleukin 25 (IL25) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with Biotin.

Interleukin 25 (IL25) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with Cy3.

Interleukin 25 (IL25) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with FITC.

Interleukin 25 (IL25) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with HRP.

Interleukin 25 (IL25) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with PE.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)

CG64-10ug 10ug
EUR 95
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)

CG64-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)

CG64-500ug 500ug
EUR 1186
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-25/IL25/MYDGF (N-6His)

CG64-50ug 50ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Interleukin 25 (IL25) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Met28~Gly177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 25 (IL25). This antibody is labeled with APC-Cy7.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with APC.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with Biotin.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with Cy3.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with FITC.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with HRP.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with PE.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), APC

  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with APC.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), Biotinylated

  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with Biotin.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), Cy3

  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with Cy3.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), FITC

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with FITC.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), HRP

  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with HRP.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), PE

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with PE.

Interleukin 25 (IL25) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Cys32~Cys148)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 25 (IL25). This antibody is labeled with APC-Cy7.

Interleukin 25 (IL25) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL25 (Pro33~Ala169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 25 (IL25). This antibody is labeled with APC-Cy7.

Human Interleukin 25,IL-25 ELISA Kit

201-12-0055 96 tests
EUR 440
  • This Interleukin 25 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 25, IL-25 ELISA kit

CSB-E11715h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 25, IL-25 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 25, IL-25 ELISA kit

  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 25, IL-25 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 25(IL-25)ELISA Kit

GA-E0094HM-48T 48T
EUR 289

Human Interleukin 25(IL-25)ELISA Kit

GA-E0094HM-96T 96T
EUR 466

Human Interleukin 25(IL-25)ELISA Kit

QY-E04286 96T
EUR 361

Human Interleukin 25 ELISA kit

E01I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 25 ELISA kit

E01I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 25 ELISA kit

E01I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human IL-25 (Interleukin 25)

E-EL-H1648 1 plate of 96 wells
EUR 534
  • Gentaur's IL-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-25. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

Mouse IL-25(Interleukin 25) ELISA Kit

EM1162 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q9CPT4
  • Alias: IL-25/IL-17E/Interleukin-17E/interleukin-25
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Rat IL-25(Interleukin 25) ELISA Kit

ER1097 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Alias: IL-25/IL-17E/Interleukin-17E/interleukin-25
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

ELISA kit for Human Interleukin-25

EK3881 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-25 in samples from serum, plasma, tissue homogenates and other biological fluids.

IL-25 ELISA Kit| Rat Interleukin 25 ELISA Kit

EF017844 96 Tests
EUR 689

IL-25 ELISA Kit| Mouse Interleukin 25 ELISA Kit

EF013718 96 Tests
EUR 689

Human IL-17E/IL-25(Interleukin 25) ELISA Kit

EH0180 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q9H293
  • Alias: IL-25/IL-17E
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human IL25 ELISA kit

55R-2185 96 tests
EUR 766
Description: ELISA Kit for detection of IL25 in the research laboratory

Human IL25 ELISA Kit

ELA-E1694h 96 Tests
EUR 824

Rat Interleukin 25 ELISA kit

E02I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 25 ELISA kit

E02I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 25 ELISA kit

E02I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 25 ELISA kit

E04I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 25 ELISA kit

E04I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 25 ELISA kit

E04I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 25 ELISA kit

E03I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 25 ELISA kit

E03I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 25 ELISA kit

E03I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 25 ELISA kit

E06I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 25 ELISA kit

E06I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 25 ELISA kit

E06I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 25 ELISA kit

E09I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 25 ELISA kit

E09I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 25 ELISA kit

E09I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 25 ELISA kit

E08I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 25 ELISA kit

E08I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 25 ELISA kit

E08I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 25 ELISA kit

E07I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 25 ELISA kit

E07I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 25 ELISA kit

E07I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse IL-25 (Interleukin 25)

E-EL-M0187 1 plate of 96 wells
EUR 534
  • Gentaur's IL-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-25. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat IL-25 (Interleukin 25)

E-EL-R2394 1 plate of 96 wells
EUR 534
  • Gentaur's IL-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IL-25. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

Human Interleukin-25 (IL-25) Antibody

32566-05111 150 ug
EUR 261

Guinea pig Interleukin 25 ELISA kit

E05I0205-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 25 ELISA kit

E05I0205-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 25 ELISA kit

E05I0205-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL25 ELISA Kit (Human) (OKAN04931)

OKAN04931 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL

IL25 ELISA Kit (Human) (OKBB00815)

OKBB00815 96 Wells
EUR 544
Description: Description of target: Interleukin-25 (IL-25), also known as interleukin-17E (IL-17E), is a protein that in humans is encoded by the IL25 gene. It is a cytokine that belongs to the IL-17 cytokine family and mapped to 14q11.2. IL-25 is secreted by type 2 helper T cells (Th2) and mast cells. It has been found that IL-25 can induce Th2-type cytokine expression and production by non-T, non-B accessory cells that express high levels of major histocompatibility complex class II and low levels of Cd11c. This cytokine also can induce NF-κB activation, and stimulate the production of IL8. What’s more, IL-25 is an important molecule controlling immunity of the gut and has been implicated in chronic inflammation associated with the gastrointestinal tract.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

IL25 ELISA Kit (Human) (OKCD07601)

OKCD07601 96 Wells
EUR 936
Description: Description of target: Recombinant Human Interleukin-17E;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.9pg/mL

Mouse Interleukin 25 (IL-25) CLIA Kit

abx195891-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Interleukin 25 (IL-25) Antibody

abx430547-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Interleukin 25 (IL-25) Antibody

abx430548-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

CLIA kit for Mouse IL-25 (Interleukin 25)

E-CL-M0138 1 plate of 96 wells
EUR 584
  • Gentaur's IL-25 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-25 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse IL-25 (Interleukin 25) in samples from Serum, Plasma, Cell supernatant

Human Interleukin-25 (IL-25) Antibody (Biotin Conjugate)

32566-05121 150 ug
EUR 369

Recombinant Human Interleukin-25/IL-25 (C-6His)

C792-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Recombinant Human Interleukin-25/IL-25 (C-6His)

C792-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Recombinant Human Interleukin-25/IL-25 (C-6His)

C792-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Recombinant Human Interleukin-25/IL-25 (C-6His)

C792-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl 1mM EDTA,pH8.0.

Express Plasmid Midiprep Kit (25 min)

EUR 468

Express Plasmid Maxiprep Kit (25 min)

EUR 610

Il25 ELISA Kit (Rat) (OKCD01599)

OKCD01599 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.8 pg/mL

IL25 ELISA Kit (Mouse) (OKCD07602)

OKCD07602 96 Wells
EUR 818
Description: Description of target: Recombinant Mouse Interleukin-17E;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL

Amyloid Beta-peptide (25-35) (human)

A1039-25 25 mg
EUR 505
Description: Met-Leu-Gly-Ile-Ile-Ala-Gly-Lys-Asn-Ser-GlyAmyloid- ? (A?) peptide is commonly found in human Alzheimer?s disease (AD) brain and is the main component of Alzheimer amyloid plaques. The predominant forms of A? in the human brain are A? (1-40) and A? (1-42).


AR02-P0011-25 25ug
EUR 473

Human Interleukin-25 (IL-25) AssayLite Antibody (FITC Conjugate)

32566-05141 150 ug
EUR 428

Human Interleukin-25 (IL-25) AssayLite Antibody (RPE Conjugate)

32566-05151 150 ug
EUR 428

Human Interleukin-25 (IL-25) AssayLite Antibody (APC Conjugate)

32566-05161 150 ug
EUR 428

Human Interleukin-25 (IL-25) AssayLite Antibody (PerCP Conjugate)

32566-05171 150 ug
EUR 471

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

IL25 Chemi-Luminescent ELISA Kit (Human) (OKCD03660)

OKCD03660 96 Wells
EUR 988
Description: Description of target: Induces activation of NF-kappa-B and stimulates production of the proinflammatory chemokine IL-8. Proinflammatory cytokine favoring Th2-type immune responses. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

IL25 ELISA Kit (Human) : 96 Wells (OKEH02794)

OKEH02794 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.10 pg/mL

Agouti-related Protein (AGRP) (25-82), human

A1134-25 25 mg
EUR 1511
Description: Agouti-related protein also called Agouti-related peptide (AgRP) is a neuropeptide produced in the brain by the AgRP/NPY neuron. It is only synthesised in NPY containing cell bodies located in the ventromedial part of the arcuate nucleus in the hypothalamus(1).

Rv0351 (GrpE)-25

AR02-P0003-25 25ug
EUR 126

Rv1009 (RpfB)-25

AR02-P0006-25 25ug
EUR 473

Rv2450c (RpfE)-25

AR02-P0007-25 25ug
EUR 473

Rv3875 (esxA)-25

AR02-P0008-25 25ug
EUR 473


AR02-P0009-25 25ug
EUR 473

Rv3131 (NfnB)-25

AR02-P0010-25 25ug
EUR 473

IL25 Antibody

39503-100ul 100ul
EUR 390

IL25 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IL25. Recognizes IL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IL25 Antibody

DF2528 200ul
EUR 304
Description: IL25 antibody detects endogenous levels of total IL25.

IL25 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL25 Antibody

ABD2528 100 ug
EUR 438


PVT17801 2 ug
EUR 258

26795 25 CLOSURE NTRL 25MM

26795-25 50/pk
EUR 96
Description: Disposable Screw Cap Culture Tubes; Poly Closures

Human MMP-25(Matrix Metalloproteinase 25) ELISA Kit

EH3372 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H239
  • Alias: MMP-25/Leukolysin/MT6-MMP/leukolysin/matrix metallopeptidase 25/matrix metallopeptidase-like 1/matrix metalloproteinase 20/matrix metalloproteinase 25/matrix metalloproteinase-25/matrix metall
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Matrix Metalloproteinase 25(MMP-25)ELISA Kit

QY-E02987 96T
EUR 361

Human Hepcidine-25 bioactive(Hepc-25) ELISA Kit

QY-E05472 96T
EUR 361

Human IL25 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human 25-hydroxycholesterol ELISA kit

E01H1400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 25-hydroxycholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 25-hydroxycholesterol ELISA kit

E01H1400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 25-hydroxycholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 25-hydroxycholesterol ELISA kit

E01H1400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 25-hydroxycholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 25 HVD3 ELISA Kit

EHA0674 96Tests
EUR 521

Human SNAP-25 ELISA Kit

EHS0043 96Tests
EUR 521


EF006985 96 Tests
EUR 689

?-Interleukin I (163-171), human

A1026-25 25 mg
EUR 212
Description: ?-Interleukin I (163-171), human(C39H64N12O19), a peptide with the sequence Val-Gln-Gly-Glu-Glu-Ser-Asn-Asp-Lys, MW= 1005. Interleukins are a group of cytokines (secreted proteins/signaling molecules) that were first seen to be expressed by white blood cells (leukocytes).

Rv2769c (PE27 protein)-25

AR02-P0001-25 25ug
EUR 203

2.5x14 cellogel 250µ (25)

EHCA1200-ST06-25 ea
EUR 38

2.5x14 cellogel 200µ (25)

EHCA1200-ST07-25 ea
EUR 38

2.5x17 cellogel 250µ (25)

EHCA1200-ST11-25 ea
EUR 41

2.5x17 cellogel 200µ (25)

EHCA1200-ST12-25 ea
EUR 41

5.7x13 cellogel 250µ (25)

EHCA1200-ST29U-25 ea
EUR 60

5.7x14 cellogel 250µ (25)

EHCA1200-ST31-25 ea
EUR 53

5.7x14 cellogel 200µ (25)

EHCA1200-ST32-25 ea
EUR 53

5.7x14 cellogel 500µ (25)

EHCA1200-ST34-25 ea
EUR 60

Hepc 25 ELISA Kit| Rat Hepcidin 25 ELISA Kit

EF018154 96 Tests
EUR 689

Hepc 25 ELISA Kit| Mouse Hepcidin 25 ELISA Kit

EF014042 96 Tests
EUR 689

BasicExoRNA? Basic RNA extraction kit (Pre-isolated exosomes, 25 reactions)

EUR 729

Human 25-Dihydroxy vitamin D3(25(OH)D3/25 HVD3)ELISA Kit

GA-E1554HM-48T 48T
EUR 289

Human 25-Dihydroxy vitamin D3(25(OH)D3/25 HVD3)ELISA Kit

GA-E1554HM-96T 96T
EUR 466

Human 25-Dihydroxy vitamin D3(25(OH)D3/25 HVD3)ELISA Kit

QY-E05233 96T
EUR 361

ELISA kit for Human MMP-25 (Matrix Metalloproteinase 25)

E-EL-H0131 1 plate of 96 wells
EUR 534
  • Gentaur's MMP-25 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MMP-25. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MMP-25 (Matrix Metalloproteinase 25) in samples from Serum, Plasma, Cell supernatant

Human 25- Dihydroxy vitamin D3, 25- HVD3 ELISA Kit

CELI-66061h 96 Tests
EUR 824

IL25 Chemi-Luminescent ELISA Kit (Rat) (OKCD03659)

OKCD03659 96 Wells
EUR 1066
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.37 pg/mL

IL25 Chemi-Luminescent ELISA Kit (Mouse) (OKCD03661)

OKCD03661 96 Wells
EUR 1027
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Mouse Hepc 25(Hepcidin 25) ELISA Kit

EM1601 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938 ng/ml

Rat Hepc 25(Hepcidin 25) ELISA Kit

ER1504 96T
EUR 476.25
  • Detection range: 1.563-100 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.5 ng/ml

DiagNano Fluorophore Labeled Gold Nanoparticles, 25 nm

GFL-25 1 mL
EUR 1053

DiaEasy? Dialyzer (3 ml) MWCO 25 kDa

EUR 490

DiaEasy? Dialyzer (250 µl) MWCO 25 kDa

EUR 349

IL25 Polyclonal Antibody

31486-100ul 100ul
EUR 252

IL25 Polyclonal Antibody

31486-50ul 50ul
EUR 187

IL25 Blocking Peptide

DF2528-BP 1mg
EUR 195

IL25 cloning plasmid

CSB-CL875653HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 534
  • Sequence: atgagggagcgacccagattaggtgaggacagttctctcattagccttttcctacaggtggttgcattcttggcaatggtcatgggaacccacacctacagccactggcccagctgctgccccagcaaagggcaggacacctctgaggagctgctgaggtggagcactgtgcctgt
  • Show more
Description: A cloning plasmid for the IL25 gene.

IL25 Rabbit pAb

A8252-100ul 100 ul
EUR 308

IL25 Rabbit pAb

A8252-200ul 200 ul
EUR 459

IL25 Rabbit pAb

A8252-20ul 20 ul
EUR 183

IL25 Rabbit pAb

A8252-50ul 50 ul
EUR 223


PVT17610 2 ug
EUR 231

Anti-IL25 antibody

STJ110551 100 µl
EUR 277
Description: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants.

ELISA kit for Human Synaptosome Associated Protein 25 (SNAP-25)  Kit

KTE62996-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Synaptosome Associated Protein 25 (SNAP-25)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptosome Associated Protein 25 (SNAP-25)  Kit

KTE62996-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Synaptosome Associated Protein 25 (SNAP-25)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Scroll to Top