Human KRT13(Keratin 13) ELISA Kit

Human KRT13(Keratin 13) ELISA Kit

To Order Contact us: [email protected]

Human Keratin 13 (KRT13) ELISA Kit
RDR-KRT13-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Keratin 13 (KRT13) ELISA Kit
RDR-KRT13-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Keratin 13 (KRT13) ELISA Kit
RD-KRT13-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Keratin 13 (KRT13) ELISA Kit
RD-KRT13-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Keratin 13 (KRT13) ELISA Kit
20-abx152106	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Keratin 13 (KRT13) ELISA Kit
abx252200-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Keratin 13 (KRT13) ELISA Kit
abx574530-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Keratin 13(KRT13)ELISA Kit
QY-E02834	Qayee Biotechnology	96T	EUR 361

Human Keratin 13 (KRT13) ELISA Kit
SEB875Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit
SEB875Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit
SEB875Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit
SEB875Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit
4-SEB875Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Keratin 13 elisa. Alternative names of the recognized antigen: CK13 Cytokeratin 13
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 13 (KRT13) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Monkey Keratin 13 (KRT13) ELISA Kit
abx359862-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Keratin 13 (KRT13) ELISA Kit
abx361624-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Keratin 13 (KRT13) ELISA Kit
abx362517-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Keratin 13 (KRT13) ELISA Kit
abx356204-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Keratin 13 (Krt13) ELISA Kit
abx518685-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Keratin 13 (Krt13) ELISA Kit
abx518686-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Keratin 13 (KRT13) Antibody
20-abx007043	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
20-abx113335	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
20-abx128817	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 13 (KRT13) Antibody
20-abx130295	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 13 (KRT13) Antibody
abx145863-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
20-abx173243	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Keratin 13 (KRT13) Antibody
abx011779-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
abx032946-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
abx032946-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
20-abx241469	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
20-abx241748	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
20-abx329125	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody
abx432902-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Keratin 13 (KRT13) Antibody
20-abx301829	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Keratin 13 (KRT13)
4-RPB875Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13646 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.7kDa Isoelectric Point: 5
Description: Recombinant Human Keratin 13 expressed in: E.coli

Recombinant Keratin 13 (KRT13)
4-RPB875Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6IFV4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.8kDa Isoelectric Point: 5.5
Description: Recombinant Rat Keratin 13 expressed in: E.coli

ELISA kit for Human KRT13 (Keratin 13)
ELK2239	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 13 (KRT13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 13 (KRT Show more
Description: A sandwich ELISA kit for detection of Keratin 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Keratin 13 (KRT13) CLIA Kit
20-abx493201	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Keratin 13 (KRT13) Protein
20-abx166967	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Keratin 13 (KRT13) Protein
20-abx167695	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 13 (KRT13) Antibody (HRP)
20-abx315816	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody (FITC)
20-abx315817	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody (Biotin)
20-abx315818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 13 (KRT13) polyclonal antibody
ABP-PAB-02125	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Human Keratin, type I cytoskeletal 13, KRT13 ELISA KIT
ELI-06022h	Lifescience Market	96 Tests	EUR 824

Keratin 13 (KRT13) Polyclonal Antibody (Rat)
4-PAB875Ra01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13)

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig)
4-PAB875Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13)

Mouse Keratin, type I cytoskeletal 13, Krt13 ELISA KIT
ELI-06021m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13)
KTE61885-48T	Abbkine	48T	EUR 332
Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13)
KTE61885-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13)
KTE61885-96T	Abbkine	96T	EUR 539
Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), APC
4-PAB875Ra01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with APC.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), Biotinylated
4-PAB875Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with Biotin.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), Cy3
4-PAB875Ra01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with Cy3.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), FITC
4-PAB875Ra01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with FITC.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), HRP
4-PAB875Ra01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with HRP.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), PE
4-PAB875Ra01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with PE.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), APC
4-PAB875Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with APC.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAB875Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with Biotin.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), Cy3
4-PAB875Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with Cy3.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), FITC
4-PAB875Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with FITC.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), HRP
4-PAB875Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with HRP.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), PE
4-PAB875Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with PE.

CK-13/KRT13 ELISA KIT|Human
EF004795	Lifescience Market	96 Tests	EUR 689

Human CK-13/KRT13(Cytokeratin 13) ELISA Kit
EH2818	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P13646 Alias: CK-13/KRT13/Cytokeratin-13/CK-13/Keratin-13/K13/Keratin, type I cytoskeletal 13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAB875Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Glu104~Ala403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with APC-Cy7.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), APC-Cy7
4-PAB875Ra01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT13 (Leu266~Gln404) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with APC-Cy7.

ELISA kit for Human CK-13/KRT13 (Cytokeratin 13)
E-EL-H2070	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CK-13/KRT13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CK-13/KRT13. Standards or samples are added to the micro ELISA plate wells and co Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CK-13/KRT13 (Cytokeratin 13) in samples from Serum, Plasma, Cell supernatant

Human Keratin 13 ELISA Kit
ELA-E9417h	Lifescience Market	96 Tests	EUR 824

Human Cytokeratin 13 / CK-13 (KRT13) CLIA Kit
abx196587-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Cytokeratin 13 (KRT13) Antibody
20-abx009057	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Cytokeratin 13 (KRT13) Antibody
abx232193-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

CLIA kit for Human CK-13/KRT13 (Cytokeratin 13)
E-CL-H1242	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's CK-13/KRT13 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CK-13/KRT13 . Standards or samples are added to the micro CLIA plate wells and comb Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CK-13/KRT13 (Cytokeratin 13) in samples from Serum, Plasma, Cell supernatant

99445-13 DCT 13 X 100MM
99445-13	CORNING	250/pk	EUR 76
Description: Disposable Culture Tubes; DCT's, CGW

Krt13/ Rat Krt13 ELISA Kit
ELI-06020r	Lifescience Market	96 Tests	EUR 886

Human KRT13 ELISA Kit
ELA-E1875h	Lifescience Market	96 Tests	EUR 824

99999 CAP 13-415
99999-13	CORNING	1000/pk	EUR 219
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps

9998 SCREW CAP 415/13
9998-13	CORNING	288/pk	EUR 198
Description: General Apparatus; Stoppers

Anti-Keratin 13 antibody
STJ16100242	St John's Laboratory	1 mL	EUR 290

Anti-Keratin 13 antibody
STJ16100243	St John's Laboratory	1 mL	EUR 290

99447 DSSCT 13 X 100MM W/ MARING SPOT
99447-13	CORNING	250/pk	EUR 332
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

99449 DSSCT 13 X 100MM W/O MARKING SPOT
99449-13	CORNING	250/pk	EUR 281
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

Human Keratin- associated protein 13- 4, KRTAP13-4 ELISA KIT
ELI-14113h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 13- 1, KRTAP13-1 ELISA KIT
ELI-19294h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 13- 3, KRTAP13-3 ELISA KIT
ELI-28023h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 13- 2, KRTAP13-2 ELISA KIT
ELI-43316h	Lifescience Market	96 Tests	EUR 824

Polyclonal KRT13 / CK13 / Cytokeratin 13 Antibody (C-Terminus)
APG01061G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KRT13 / CK13 / Cytokeratin 13 (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-Keratin 13+10 antibody
STJ16101020	St John's Laboratory	100 µg	EUR 354

CA199 (Cancer antigen) ELISA test
13	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

KRT13 antibody
70R-18179	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KRT13 antibody

KRT13 Antibody
35558-100ul	SAB	100ul	EUR 252

KRT13 Antibody
1-CSB-PA002017	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

KRT13 Antibody
1-CSB-PA441632	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:5-1:20

KRT13 Antibody
1-CSB-PA297945	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:5-1:20

KRT13 Antibody
BF0051	Affbiotech	200ul	EUR 376
Description: KRT13 antibody detects endogenous levels of total KRT13.

KRT13 Antibody
1-CSB-PA012511GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

KRT13 Antibody
1-CSB-PA012511LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KRT13 siRNA
20-abx902891	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT13 siRNA
20-abx921947	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT13 siRNA
20-abx921948	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Monoclonal KRT13 / CK13 / Cytokeratin 13 Antibody (clone AE8), Clone: AE8
AMM01786G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human KRT13 / CK13 / Cytokeratin 13 (clone AE8). The antibodies are raised in Mouse and are from clone AE8. This antibody is applicable in WB and IHC-P

Human KRT13 shRNA Plasmid
20-abx952620	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KRT13 Recombinant Protein (Human)
RP040483	ABM	100 ug	Ask for price

Human Interleukin 13,IL-13 ELISA KIT
201-12-0099	SunredBio	96 tests	EUR 440
This Interleukin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cytokeratin 13,CK-13 ELISA Kit
201-12-1608	SunredBio	96 tests	EUR 440
This cytokeratin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 13, IL-13 ELISA KIT
CSB-E04601h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 13, IL-13 ELISA KIT
1-CSB-E04601h	Cusabio	EUR 603.00 EUR 4247.00 EUR 2260.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human IL-13(Interleukin 13) ELISA Kit
EH3266	FN Test	96T	EUR 476.25
Detection range: 15.625-1000 pg/ml Uniprot ID: P35225 Alias: IL-13(Interleukin 13)/BHR1interleukin-13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 13,IL-13 ELISA KIT
CN-03217H1	ChemNorm	96T	EUR 434

Human Interleukin 13,IL-13 ELISA KIT
CN-03217H2	ChemNorm	48T	EUR 284

Human cytokeratin 13(CK-13)ELISA Kit
GA-E1624HM-48T	GenAsia Biotech	48T	EUR 289

Human cytokeratin 13(CK-13)ELISA Kit
GA-E1624HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 13(IL-13)ELISA Kit
GA-E0138HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 13(IL-13)ELISA Kit
GA-E0138HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin-13 (IL-13) ELISA Kit
LF-EK60050	Abfrontier	1×96T	EUR 790

Human cytokeratin 13(CK-13)ELISA Kit
QY-E00980	Qayee Biotechnology	96T	EUR 361

Human Interleukin 13(IL-13)ELISA Kit
QY-E04326	Qayee Biotechnology	96T	EUR 361

Human ADAMTS -13(ADAMTS -13) ELISA Kit
QY-E05516	Qayee Biotechnology	96T	EUR 361

Human Keratin 9 ELISA Kit
ELA-E2283h	Lifescience Market	96 Tests	EUR 824

Human Keratin 8 ELISA Kit
ELA-E2287h	Lifescience Market	96 Tests	EUR 824

Human Keratin 16 ELISA Kit
ELA-E8852h	Lifescience Market	96 Tests	EUR 824

Human Keratin 15 ELISA Kit
ELA-E8853h	Lifescience Market	96 Tests	EUR 824

Human Keratin 12 ELISA Kit
ELA-E8860h	Lifescience Market	96 Tests	EUR 824

Human Keratin 19 ELISA Kit
ELA-E9126h	Lifescience Market	96 Tests	EUR 824

Human Keratin 20 ELISA Kit
ELA-E9127h	Lifescience Market	96 Tests	EUR 824

Human Matrix metalloproteinase 13,MMP-13 ELISA kit
201-12-0912	SunredBio	96 tests	EUR 440
This Matrix metalloproteinase 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human IL-13 (Interleukin 13)
E-EL-H0104	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-13. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant

Human Matrix metalloproteinase 13, MMP-13 ELISA kit
CSB-E04674h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Matrix metalloproteinase 13, MMP-13 ELISA kit
1-CSB-E04674h	Cusabio	EUR 723.00 EUR 4883.00 EUR 2591.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Matrix metalloproteinase 13,MMP-13 ELISA kit
CN-03225H1	ChemNorm	96T	EUR 448

Human Matrix metalloproteinase 13,MMP-13 ELISA kit
CN-03225H2	ChemNorm	48T	EUR 297

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit
GA-E0928HM-48T	GenAsia Biotech	48T	EUR 289

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit
GA-E0928HM-96T	GenAsia Biotech	96T	EUR 466

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit
QY-E02998	Qayee Biotechnology	96T	EUR 361

KRT13 Conjugated Antibody
C35558	SAB	100ul	EUR 397

KRT13 Blocking Peptide
BF0051-BP	Affbiotech	1mg	EUR 195

KRT13 cloning plasmid
CSB-CL012511HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1377 Sequence: atgagcctccgcctgcagagctcctctgccagctatggaggtggtttcgggggtggctcttgccagctgggaggaggccgtggtgtctctacctgttcaactcggtttgtgtctgggggatcagctgggggctatggaggcggcgtgagctgtggttttggtggaggggctggta Show more
Description: A cloning plasmid for the KRT13 gene.

KRT13 Rabbit pAb
A7697-100ul	Abclonal	100 ul	EUR 308

KRT13 Rabbit pAb
A7697-200ul	Abclonal	200 ul	EUR 459

KRT13 Rabbit pAb
A7697-20ul	Abclonal	20 ul	EUR 183

KRT13 Rabbit pAb
A7697-50ul	Abclonal	50 ul	EUR 223

KRT13 Rabbit pAb
A16393-100ul	Abclonal	100 ul	EUR 308

KRT13 Rabbit pAb
A16393-200ul	Abclonal	200 ul	EUR 459

KRT13 Rabbit pAb
A16393-20ul	Abclonal	20 ul	EUR 183

KRT13 Rabbit pAb
A16393-50ul	Abclonal	50 ul	EUR 223

anti-KRT13 (3G4)
LF-MA30754	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to KRT13

pCR4-TOPO-KRT13
PVT17821	Lifescience Market	2 ug	EUR 231

Anti-KRT13 antibody
STJ118833	St John's Laboratory	100 µl	EUR 277

Anti-KRT13 antibody
STJ110010	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described.

Anti-KRT13 antibody
STJ71779	St John's Laboratory	100 µg	EUR 359

KRT13 ORF Vector (Human) (pORF)
ORF013495	ABM	1.0 ug DNA	EUR 354

Human IL-13 ELISA kit
CT208A	U-CyTech	5-plate	EUR 462

Human CytoKeratin 13 ELISA kit
E01C0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 13 ELISA kit
E01C0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 13 ELISA kit
E01C0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apelin 13 ELISA kit
E01A0036-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.