Human KRT13(Keratin 13) ELISA Kit

Human KRT13(Keratin 13) ELISA Kit

To Order Contact us: [email protected]

Human Keratin 13 (KRT13) ELISA Kit

RDR-KRT13-Hu-48Tests 48 Tests
EUR 522

Human Keratin 13 (KRT13) ELISA Kit

RDR-KRT13-Hu-96Tests 96 Tests
EUR 724

Human Keratin 13 (KRT13) ELISA Kit

RD-KRT13-Hu-48Tests 48 Tests
EUR 500

Human Keratin 13 (KRT13) ELISA Kit

RD-KRT13-Hu-96Tests 96 Tests
EUR 692

Human Keratin 13 (KRT13) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Keratin 13 (KRT13) ELISA Kit

abx252200-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Keratin 13 (KRT13) ELISA Kit

abx574530-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Keratin 13(KRT13)ELISA Kit

QY-E02834 96T
EUR 361

Human Keratin 13 (KRT13) ELISA Kit

SEB875Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit

SEB875Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit

SEB875Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit

SEB875Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 13 (KRT13) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 13 elisa. Alternative names of the recognized antigen: CK13
  • Cytokeratin 13
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 13 (KRT13) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Keratin 13 (KRT13) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 13 (KRT13) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 13 (KRT13) Antibody

abx145863-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Keratin 13 (KRT13) Antibody

abx011779-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

abx032946-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

abx032946-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody

abx432902-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Keratin 13 (KRT13) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Keratin 13 (KRT13)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P13646
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.7kDa
  • Isoelectric Point: 5
Description: Recombinant Human Keratin 13 expressed in: E.coli

Recombinant Keratin 13 (KRT13)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6IFV4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.8kDa
  • Isoelectric Point: 5.5
Description: Recombinant Rat Keratin 13 expressed in: E.coli

Monkey Keratin 13 (KRT13) ELISA Kit

abx359862-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Keratin 13 (KRT13) ELISA Kit

abx361624-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Keratin 13 (KRT13) ELISA Kit

abx362517-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Keratin 13 (KRT13) ELISA Kit

abx356204-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Keratin 13 (Krt13) ELISA Kit

abx518685-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Keratin 13 (Krt13) ELISA Kit

abx518686-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human KRT13 (Keratin 13)

ELK2239 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 13 (KRT13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 13 (KRT
  • Show more
Description: A sandwich ELISA kit for detection of Keratin 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Keratin 13 (KRT13) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Keratin 13 (KRT13) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Keratin 13 (KRT13) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 13 (KRT13) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 13 (KRT13) polyclonal antibody

ABP-PAB-02125 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Human Keratin, type I cytoskeletal 13, KRT13 ELISA KIT

ELI-06022h 96 Tests
EUR 824

Keratin 13 (KRT13) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13)

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13)

Mouse Keratin, type I cytoskeletal 13, Krt13 ELISA KIT

ELI-06021m 96 Tests
EUR 865

ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13)

KTE61885-48T 48T
EUR 332
  • Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13)

KTE61885-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13)

KTE61885-96T 96T
EUR 539
  • Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with APC.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with Biotin.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with Cy3.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with FITC.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with HRP.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with PE.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with APC.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with Biotin.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with Cy3.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with FITC.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with HRP.

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with PE.


EF004795 96 Tests
EUR 689

Human CK-13/KRT13(Cytokeratin 13) ELISA Kit

EH2818 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P13646
  • Alias: CK-13/KRT13/Cytokeratin-13/CK-13/Keratin-13/K13/Keratin, type I cytoskeletal 13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Glu104~Ala403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with APC-Cy7.

Keratin 13 (KRT13) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT13 (Leu266~Gln404)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with APC-Cy7.

ELISA kit for Human CK-13/KRT13 (Cytokeratin 13)

E-EL-H2070 1 plate of 96 wells
EUR 534
  • Gentaur's CK-13/KRT13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CK-13/KRT13. Standards or samples are added to the micro ELISA plate wells and co
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CK-13/KRT13 (Cytokeratin 13) in samples from Serum, Plasma, Cell supernatant

Human Keratin 13 ELISA Kit

ELA-E9417h 96 Tests
EUR 824

Human Cytokeratin 13 / CK-13 (KRT13) CLIA Kit

abx196587-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cytokeratin 13 (KRT13) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cytokeratin 13 (KRT13) Antibody

abx232193-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CLIA kit for Human CK-13/KRT13 (Cytokeratin 13)

E-CL-H1242 1 plate of 96 wells
EUR 584
  • Gentaur's CK-13/KRT13 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CK-13/KRT13 . Standards or samples are added to the micro CLIA plate wells and comb
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CK-13/KRT13 (Cytokeratin 13) in samples from Serum, Plasma, Cell supernatant

99445-13 DCT 13 X 100MM

99445-13 250/pk
EUR 76
Description: Disposable Culture Tubes; DCT's, CGW

Krt13/ Rat Krt13 ELISA Kit

ELI-06020r 96 Tests
EUR 886

Human KRT13 ELISA Kit

ELA-E1875h 96 Tests
EUR 824

99999 CAP 13-415

99999-13 1000/pk
EUR 219
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps

9998 SCREW CAP 415/13

9998-13 288/pk
EUR 198
Description: General Apparatus; Stoppers

KRT13 ELISA Kit (Human) (OKCD02675)

OKCD02675 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

KRT13 ELISA Kit (Human) (OKEH07026)

OKEH07026 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

Anti-Keratin 13 antibody

STJ16100242 1 mL
EUR 290

Anti-Keratin 13 antibody

STJ16100243 1 mL
EUR 290


99447-13 250/pk
EUR 332
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

Human Keratin- associated protein 13- 4, KRTAP13-4 ELISA KIT

ELI-14113h 96 Tests
EUR 824

Human Keratin- associated protein 13- 1, KRTAP13-1 ELISA KIT

ELI-19294h 96 Tests
EUR 824

Human Keratin- associated protein 13- 3, KRTAP13-3 ELISA KIT

ELI-28023h 96 Tests
EUR 824

Human Keratin- associated protein 13- 2, KRTAP13-2 ELISA KIT

ELI-43316h 96 Tests
EUR 824

Polyclonal KRT13 / CK13 / Cytokeratin 13 Antibody (C-Terminus)

APG01061G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KRT13 / CK13 / Cytokeratin 13 (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-Keratin 13+10 antibody

STJ16101020 100 µg
EUR 354


99449-13 250/pk
EUR 281
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

KRT13 ELISA Kit (Rat) (OKEH06090)

OKEH06090 96 Wells
EUR 662
Description: Description of target: human homolog plays a role in epidermal development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41.2 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

CA199 (Cancer antigen) ELISA test

13 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

KRT13 antibody

70R-18179 50 ul
EUR 435
Description: Rabbit polyclonal KRT13 antibody

KRT13 Antibody

35558-100ul 100ul
EUR 252

KRT13 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

KRT13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:5-1:20

KRT13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:5-1:20

KRT13 Antibody

BF0051 200ul
EUR 376
Description: KRT13 antibody detects endogenous levels of total KRT13.

KRT13 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

KRT13 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal KRT13 / CK13 / Cytokeratin 13 Antibody (clone AE8), Clone: AE8

AMM01786G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human KRT13 / CK13 / Cytokeratin 13 (clone AE8). The antibodies are raised in Mouse and are from clone AE8. This antibody is applicable in WB and IHC-P

Human KRT13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KRT13 Recombinant Protein (Human)

RP040483 100 ug Ask for price

Human Interleukin 13,IL-13 ELISA KIT

201-12-0099 96 tests
EUR 440
  • This Interleukin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cytokeratin 13,CK-13 ELISA Kit

201-12-1608 96 tests
EUR 440
  • This cytokeratin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 13, IL-13 ELISA KIT

CSB-E04601h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 13, IL-13 ELISA KIT

  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human IL-13(Interleukin 13) ELISA Kit

EH3266 96T
EUR 476.25
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P35225
  • Alias: IL-13(Interleukin 13)/BHR1interleukin-13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 13,IL-13 ELISA KIT

CN-03217H1 96T
EUR 434

Human Interleukin 13,IL-13 ELISA KIT

CN-03217H2 48T
EUR 284

Human cytokeratin 13(CK-13)ELISA Kit

GA-E1624HM-48T 48T
EUR 289

Human cytokeratin 13(CK-13)ELISA Kit

GA-E1624HM-96T 96T
EUR 466

Human Interleukin 13(IL-13)ELISA Kit

GA-E0138HM-48T 48T
EUR 289

Human Interleukin 13(IL-13)ELISA Kit

GA-E0138HM-96T 96T
EUR 466

Human Interleukin-13 (IL-13) ELISA Kit

LF-EK60050 1×96T
EUR 790

Human cytokeratin 13(CK-13)ELISA Kit

QY-E00980 96T
EUR 361

Human Interleukin 13(IL-13)ELISA Kit

QY-E04326 96T
EUR 361

Human ADAMTS -13(ADAMTS -13) ELISA Kit

QY-E05516 96T
EUR 361

Human Keratin 9 ELISA Kit

ELA-E2283h 96 Tests
EUR 824

Human Keratin 8 ELISA Kit

ELA-E2287h 96 Tests
EUR 824

Human Keratin 16 ELISA Kit

ELA-E8852h 96 Tests
EUR 824

Human Keratin 15 ELISA Kit

ELA-E8853h 96 Tests
EUR 824

Human Keratin 12 ELISA Kit

ELA-E8860h 96 Tests
EUR 824

Human Keratin 19 ELISA Kit

ELA-E9126h 96 Tests
EUR 824

Human Keratin 20 ELISA Kit

ELA-E9127h 96 Tests
EUR 824

KRT13 Western Blot kit (AWBK42031)

AWBK42031 10 reactions
EUR 647
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

KRT13 Conjugated Antibody

C35558 100ul
EUR 397

KRT13 Blocking Peptide

BF0051-BP 1mg
EUR 195

KRT13 cloning plasmid

CSB-CL012511HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1377
  • Sequence: atgagcctccgcctgcagagctcctctgccagctatggaggtggtttcgggggtggctcttgccagctgggaggaggccgtggtgtctctacctgttcaactcggtttgtgtctgggggatcagctgggggctatggaggcggcgtgagctgtggttttggtggaggggctggta
  • Show more
Description: A cloning plasmid for the KRT13 gene.

KRT13 Rabbit pAb

A7697-100ul 100 ul
EUR 308

KRT13 Rabbit pAb

A7697-200ul 200 ul
EUR 459

KRT13 Rabbit pAb

A7697-20ul 20 ul
EUR 183

KRT13 Rabbit pAb

A7697-50ul 50 ul
EUR 223

KRT13 Rabbit pAb

A16393-100ul 100 ul
EUR 308

KRT13 Rabbit pAb

A16393-200ul 200 ul
EUR 459

KRT13 Rabbit pAb

A16393-20ul 20 ul
EUR 183

KRT13 Rabbit pAb

A16393-50ul 50 ul
EUR 223

anti-KRT13 (3G4)

LF-MA30754 100 ul
EUR 527
Description: Mouse Monoclonal to KRT13


PVT17821 2 ug
EUR 231

Anti-KRT13 antibody

STJ118833 100 µl
EUR 277

Anti-KRT13 antibody

STJ110010 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described.

Anti-KRT13 antibody

STJ71779 100 µg
EUR 359

Human Matrix metalloproteinase 13,MMP-13 ELISA kit

201-12-0912 96 tests
EUR 440
  • This Matrix metalloproteinase 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human IL-13 (Interleukin 13)

E-EL-H0104 1 plate of 96 wells
EUR 534
  • Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-13. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant

Human Matrix metalloproteinase 13, MMP-13 ELISA kit

CSB-E04674h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Matrix metalloproteinase 13, MMP-13 ELISA kit

  • EUR 723.00
  • EUR 4883.00
  • EUR 2591.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Matrix metalloproteinase 13,MMP-13 ELISA kit

CN-03225H1 96T
EUR 448

Human Matrix metalloproteinase 13,MMP-13 ELISA kit

CN-03225H2 48T
EUR 297

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit

GA-E0928HM-48T 48T
EUR 289

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit

GA-E0928HM-96T 96T
EUR 466

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit

QY-E02998 96T
EUR 361

KRT13 ORF Vector (Human) (pORF)

ORF013495 1.0 ug DNA
EUR 354

Keratin-Associated Protein 13-3 (KRTAP13-3) Antibody

abx026808-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Scroll to Top